Rh3CG307000

Regulatory subunit of the dimeric E1 enzyme. E1 activates RUB1 NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a RUB1-ECR1 thioester and free AMP. E1 finally transfers RUB1 to the catalytic cysteine of RCE1

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
32079974 .. 32094013
14040 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG307000.1

Sequence Viewer

Length: 297 bp
ATGTCCTTCATTTTCTCTATGGTTTTCTGGGTGCAGAAACATACTGTGATTGAGTCCAAGCCTGAACATTTTCTGGATGACCTTCGTTTGAATAATCCATGGCCTGAGCTTAGAAGGTACAGAGAGCTTATCAAAACTAGGATGACTGCAGATGATGTAGATAACTACAGTGAAGCATTGAGAACTCCTTTAAAGTCTTTACTCCTTGAGGAATTAGAATTCCTAGCAAATGAAGGTGGTGGTGAGGCACCCCTCGAGGGATCAGTACCAGATATAACATCTTCAACTGACATGTAG

Protein Analysis

98

Amino Acids

11.33

Weight (kDa)

4.61

Isoelectric Point (pI)

36.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 254
AccB1I GGYRCC 1 cut(s) 247
AclWI GGATC 1 cut(s) 268
AcsI RAATTY 1 cut(s) 218
AfaI GTAC 2 cut(s) 119, 267
AfiI CCNNNNNNNGG 1 cut(s) 257
AflIII ACRYGT 1 cut(s) 291
AgsI TTSAA 2 cut(s) 91, 285
AluBI AGCT 2 cut(s) 109, 127
AluI AGCT 2 cut(s) 109, 127
AlwI GGATC 1 cut(s) 268
Ama87I CYCGRG 1 cut(s) 254
AoxI GGCC 1 cut(s) 101
ApoI RAATTY 1 cut(s) 218
Asp700I GAANNNNTTC 1 cut(s) 69
AsuHPI GGTGA 1 cut(s) 254
AvaI CYCGRG 1 cut(s) 254
BanI GGYRCC 1 cut(s) 247
BfaI CTAG 2 cut(s) 138, 224
BfmI CTRYAG 2 cut(s) 147, 166
BmeT110I CYCGRG 1 cut(s) 254
BmiI GGNNCC 1 cut(s) 249
Bpu10I CCTNAGC 1 cut(s) 105
BpuEI CTTGAG 1 cut(s) 227
BsaJI CCNNGG 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 257
BseDI CCNNGG 1 cut(s) 98
BseGI GGATG 2 cut(s) 82, 147
BseLI CCNNNNNNNGG 1 cut(s) 257
BseMII CTCAG 1 cut(s) 96
BsgI GTGCAG 1 cut(s) 53
BshFI GGCC 1 cut(s) 103
BshNI GGYRCC 1 cut(s) 247
BsiHKCI CYCGRG 1 cut(s) 254
BslI CCNNNNNNNGG 1 cut(s) 257
BsnI GGCC 1 cut(s) 103
BsoBI CYCGRG 1 cut(s) 254
Bsp143I GATC 1 cut(s) 260
Bsp19I CCATGG 1 cut(s) 98
BspANI GGCC 1 cut(s) 103
BspCNI CTCAG 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 249
BspMAI CTGCAG 1 cut(s) 151
BspPI GGATC 1 cut(s) 268
BspT107I GGYRCC 1 cut(s) 247
BssECI CCNNGG 1 cut(s) 98
BssMI GATC 1 cut(s) 260
BssT1I CCWWGG 1 cut(s) 98
Bst4CI ACNGT 2 cut(s) 46, 170
BstDEI CTNAG 2 cut(s) 105, 110
BstDSI CCRYGG 1 cut(s) 98
BstF5I GGATG 2 cut(s) 82, 147
BstKTI GATC 1 cut(s) 263
BstMBI GATC 1 cut(s) 260
BstNSI RCATGY 1 cut(s) 295
BstSFI CTRYAG 2 cut(s) 147, 166
BsuRI GGCC 1 cut(s) 103
BtgI CCRYGG 1 cut(s) 98
BtsCI GGATG 2 cut(s) 82, 147
BtsIMutI CAGTG 1 cut(s) 175
Csp6I GTAC 2 cut(s) 118, 266
CviAII CATG 2 cut(s) 99, 292
CviJI RGCY 4 cut(s) 61, 103, 109, 127
CviKI_1 RGCY 4 cut(s) 61, 103, 109, 127
CviQI GTAC 2 cut(s) 118, 266
DdeI CTNAG 2 cut(s) 105, 110
DpnI GATC 1 cut(s) 262
DpnII GATC 1 cut(s) 260
DraI TTTAAA 1 cut(s) 192
Eco130I CCWWGG 1 cut(s) 98
Eco88I CYCGRG 1 cut(s) 254
EcoRI GAATTC 1 cut(s) 218
EcoT14I CCWWGG 1 cut(s) 98
ErhI CCWWGG 1 cut(s) 98
FaeI CATG 2 cut(s) 102, 295
FaiI YATR 5 cut(s) 20, 42, 100, 275, 293
FatI CATG 2 cut(s) 98, 291
FokI GGATG 2 cut(s) 89, 154
FspBI CTAG 2 cut(s) 138, 224
HaeIII GGCC 1 cut(s) 103
Hin1II CATG 2 cut(s) 102, 295
HinfI GANTC 1 cut(s) 53
HphI GGTGA 1 cut(s) 254
Hpy188III TCNNGA 1 cut(s) 74
HpyAV CCTTC 4 cut(s) 16, 92, 108, 227
HpyCH4III ACNGT 2 cut(s) 46, 170
HpyCH4V TGCA 2 cut(s) 34, 149
HpyF3I CTNAG 2 cut(s) 105, 110
Hsp92II CATG 2 cut(s) 102, 295
Kzo9I GATC 1 cut(s) 260
LpnPI CCDG 5 cut(s) 13, 59, 75, 117, 282
MaeI CTAG 2 cut(s) 138, 224
MalI GATC 1 cut(s) 262
MboI GATC 1 cut(s) 260
MboII GAAGA 1 cut(s) 273
MluCI AATT 2 cut(s) 212, 218
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 4 cut(s) 202, 238, 250, 263
MroXI GAANNNNTTC 1 cut(s) 69
MseI TTAA 1 cut(s) 191
NcoI CCATGG 1 cut(s) 98
NdeII GATC 1 cut(s) 260
NlaIII CATG 2 cut(s) 102, 295
NlaIV GGNNCC 1 cut(s) 249
NspI RCATGY 1 cut(s) 295
PaeR7I CTCGAG 1 cut(s) 254
PciI ACATGT 1 cut(s) 291
PdmI GAANNNNTTC 1 cut(s) 69
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
PscI ACATGT 1 cut(s) 291
PspN4I GGNNCC 1 cut(s) 249
PspXI VCTCGAGB 1 cut(s) 254
PstI CTGCAG 1 cut(s) 151
RsaI GTAC 2 cut(s) 119, 267
RsaNI GTAC 2 cut(s) 118, 266
SaqAI TTAA 1 cut(s) 191
Sau3AI GATC 1 cut(s) 260
SchI GAGTC 1 cut(s) 62
SetI ASST 5 cut(s) 84, 111, 119, 129, 238
SfcI CTRYAG 2 cut(s) 147, 166
Sfr274I CTCGAG 1 cut(s) 254
SlaI CTCGAG 1 cut(s) 254
SmlI CTYRAG 2 cut(s) 206, 254
SmoI CTYRAG 2 cut(s) 206, 254
Sse9I AATT 2 cut(s) 212, 218
SspMI CTAG 2 cut(s) 138, 224
StyI CCWWGG 1 cut(s) 98
TaaI ACNGT 2 cut(s) 46, 170
TaqI TCGA 1 cut(s) 255
TasI AATT 2 cut(s) 212, 218
Tru1I TTAA 1 cut(s) 191
Tru9I TTAA 1 cut(s) 191
TscAI CASTG 1 cut(s) 175
TspDTI ATGAA 1 cut(s) 246
TspRI CASTG 1 cut(s) 175
XapI RAATTY 1 cut(s) 218
XceI RCATGY 1 cut(s) 295
XhoI CTCGAG 1 cut(s) 254
XmnI GAANNNNTTC 1 cut(s) 69
XspI CTAG 2 cut(s) 138, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.