RchiOBHm_Chr1g0351381

Amino-acid permease

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
44646980 .. 44649233
2254 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57717

Sequence Viewer

Length: 165 bp
ATGACACTCTTCACCGGAATCACTCCTTTGTATGGTTCTAGCCTTGTATATGCAAGTCCTACAAGCCTTGTGTGGGGTTGGGTGGTAGCATCATTTTTCACCTGGTTTGTTGGACTTGCCATGGTAGGGATCTGCTCTTCTTTCCCGATTGCAAGAATTATATAG

Protein Analysis

54

Amino Acids

5.86

Weight (kDa)

7.95

Isoelectric Point (pI)

17.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 137
AfiI CCNNNNNNNGG 3 cut(s) 32, 73, 126
AjnI CCWGG 1 cut(s) 101
AlwI GGATC 1 cut(s) 137
AsuHPI GGTGA 2 cut(s) 4, 91
BciT130I CCWGG 1 cut(s) 103
BfaI CTAG 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 103
BmsI GCATC 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 120
BsaWI WCCGGW 1 cut(s) 14
Bsc4I CCNNNNNNNGG 3 cut(s) 32, 73, 126
BseBI CCWGG 1 cut(s) 103
BseDI CCNNGG 1 cut(s) 120
BseLI CCNNNNNNNGG 3 cut(s) 32, 73, 126
BsiSI CCGG 1 cut(s) 15
BslI CCNNNNNNNGG 3 cut(s) 32, 73, 126
Bsp143I GATC 1 cut(s) 129
Bsp19I CCATGG 1 cut(s) 120
BspPI GGATC 1 cut(s) 137
BspQI GCTCTTC 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 120
BssMI GATC 1 cut(s) 129
BssT1I CCWWGG 1 cut(s) 120
Bst2UI CCWGG 1 cut(s) 103
Bst6I CTCTTC 2 cut(s) 14, 142
BstDSI CCRYGG 1 cut(s) 120
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstNI CCWGG 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 101
BstX2I RGATCY 1 cut(s) 129
BstYI RGATCY 1 cut(s) 129
BtgI CCRYGG 1 cut(s) 120
CsiI ACCWGGT 1 cut(s) 101
CviAII CATG 1 cut(s) 121
CviJI RGCY 2 cut(s) 42, 66
CviKI_1 RGCY 2 cut(s) 42, 66
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
Eam1104I CTCTTC 2 cut(s) 14, 142
EarI CTCTTC 2 cut(s) 14, 142
Eco130I CCWWGG 1 cut(s) 120
EcoRII CCWGG 1 cut(s) 101
EcoT14I CCWWGG 1 cut(s) 120
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 1 cut(s) 124
FaiI YATR 6 cut(s) 33, 49, 51, 122, 161, 163
FatI CATG 1 cut(s) 120
FspBI CTAG 1 cut(s) 39
HapII CCGG 1 cut(s) 15
Hin1II CATG 1 cut(s) 124
HinfI GANTC 1 cut(s) 18
HpaII CCGG 1 cut(s) 15
HphI GGTGA 2 cut(s) 4, 91
Hpy188III TCNNGA 1 cut(s) 145
HpyCH4V TGCA 2 cut(s) 53, 152
Hsp92II CATG 1 cut(s) 124
Kzo9I GATC 1 cut(s) 129
LguI GCTCTTC 1 cut(s) 142
LpnPI CCDG 3 cut(s) 28, 88, 115
LweI GCATC 1 cut(s) 98
MabI ACCWGGT 1 cut(s) 101
MaeI CTAG 1 cut(s) 39
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MboII GAAGA 1 cut(s) 129
MflI RGATCY 1 cut(s) 129
MluCI AATT 1 cut(s) 156
MmeI TCCRAC 1 cut(s) 91
MspI CCGG 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 103
MvaI CCWGG 1 cut(s) 103
NcoI CCATGG 1 cut(s) 120
NdeII GATC 1 cut(s) 129
NlaIII CATG 1 cut(s) 124
PciSI GCTCTTC 1 cut(s) 142
PfeI GAWTC 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 101
PspGI CCWGG 1 cut(s) 101
PsuI RGATCY 1 cut(s) 129
SapI GCTCTTC 1 cut(s) 142
Sau3AI GATC 1 cut(s) 129
ScrFI CCNGG 1 cut(s) 103
SetI ASST 1 cut(s) 104
SexAI ACCWGGT 1 cut(s) 101
SfaNI GCATC 1 cut(s) 98
Sse9I AATT 1 cut(s) 156
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 101
StyI CCWWGG 1 cut(s) 120
TasI AATT 1 cut(s) 156
TfiI GAWTC 1 cut(s) 18
XspI CTAG 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.