Rh7AG476100

Amino-acid permease

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
66513492 .. 66525684
12193 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG476100.1

Sequence Viewer

Length: 267 bp
ATGGGACAGAACCAAGTAGATGCATCACAAATCCAAGAGATGGATTCAGGGGAAAAGCGACTTAATGAGCTTGGTTACAAGCAAGAACTCAGAAGAGAGATGACTTTGTTCAAAACTCTTGCAATATCATTCTCGACGATGACACTCTTCACCAGAATCACTCCTTTGTATGGTTCTAGCCTTGGAAAGGATCGATATCCTGGAAATCAACCATCCCGAAAGTCCTGTCGGCACAAAGTCCAGAGTGATATGAAATTTTATTTTTAA

Protein Analysis

88

Amino Acids

10.25

Weight (kDa)

9.61

Isoelectric Point (pI)

47.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 40
AclWI GGATC 1 cut(s) 198
AcsI RAATTY 1 cut(s) 254
AfiI CCNNNNNNNGG 3 cut(s) 40, 170, 187
AgsI TTSAA 1 cut(s) 112
AjnI CCWGG 1 cut(s) 199
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
AlwI GGATC 1 cut(s) 198
ApoI RAATTY 1 cut(s) 254
ArsI GACNNNNNNTTYG 2 cut(s) 211, 243
AsuHPI GGTGA 1 cut(s) 142
BccI CCATC 2 cut(s) 34, 220
BciT130I CCWGG 1 cut(s) 201
BfaI CTAG 1 cut(s) 177
Bme1390I CCNGG 1 cut(s) 201
BmrFI CCNGG 1 cut(s) 201
BmsI GCATC 2 cut(s) 10, 32
Bsa29I ATCGAT 1 cut(s) 193
BsaBI GATNNNNATC 1 cut(s) 195
BsaJI CCNNGG 1 cut(s) 181
Bsc4I CCNNNNNNNGG 3 cut(s) 40, 170, 187
Bse8I GATNNNNATC 1 cut(s) 195
BseBI CCWGG 1 cut(s) 201
BseCI ATCGAT 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 181
BseGI GGATG 1 cut(s) 212
BseJI GATNNNNATC 1 cut(s) 195
BseLI CCNNNNNNNGG 3 cut(s) 40, 170, 187
BseMII CTCAG 1 cut(s) 103
BshVI ATCGAT 1 cut(s) 193
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 3 cut(s) 40, 170, 187
BsmFI GGGAC 1 cut(s) 18
Bsp143I GATC 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 102
BspDI ATCGAT 1 cut(s) 193
BspPI GGATC 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 181
BssMI GATC 1 cut(s) 190
BssT1I CCWWGG 1 cut(s) 181
Bst2UI CCWGG 1 cut(s) 201
Bst6I CTCTTC 2 cut(s) 88, 152
BstDEI CTNAG 1 cut(s) 89
BstENI CCTNNNNNAGG 1 cut(s) 185
BstF5I GGATG 1 cut(s) 212
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
Bsu15I ATCGAT 1 cut(s) 193
BsuTUI ATCGAT 1 cut(s) 193
BtsCI GGATG 1 cut(s) 212
ClaI ATCGAT 1 cut(s) 193
CviJI RGCY 2 cut(s) 70, 180
CviKI_1 RGCY 2 cut(s) 70, 180
DdeI CTNAG 1 cut(s) 89
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eam1104I CTCTTC 2 cut(s) 88, 152
EarI CTCTTC 2 cut(s) 88, 152
Eco130I CCWWGG 1 cut(s) 181
Eco32I GATATC 1 cut(s) 197
EcoNI CCTNNNNNAGG 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 199
EcoRV GATATC 1 cut(s) 197
EcoT14I CCWWGG 1 cut(s) 181
EcoT22I ATGCAT 1 cut(s) 25
ErhI CCWWGG 1 cut(s) 181
FaiI YATR 2 cut(s) 171, 251
FaqI GGGAC 1 cut(s) 18
FokI GGATG 1 cut(s) 199
FspBI CTAG 1 cut(s) 177
HinfI GANTC 2 cut(s) 44, 156
HphI GGTGA 1 cut(s) 142
Hpy188I TCNGA 1 cut(s) 92
Hpy188III TCNNGA 3 cut(s) 133, 216, 241
Hpy99I CGWCG 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 23, 122
HpyF3I CTNAG 1 cut(s) 89
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 6 cut(s) 33, 166, 186, 213, 238, 254
LweI GCATC 2 cut(s) 10, 32
MaeI CTAG 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 74
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 2 cut(s) 105, 139
MluCI AATT 1 cut(s) 254
Mph1103I ATGCAT 1 cut(s) 25
MseI TTAA 2 cut(s) 63, 265
MspR9I CCNGG 1 cut(s) 201
MvaI CCWGG 1 cut(s) 201
NdeII GATC 1 cut(s) 190
NsiI ATGCAT 1 cut(s) 25
PfeI GAWTC 2 cut(s) 44, 156
PflMI CCANNNNNTGG 1 cut(s) 40
PfoI TCCNGGA 1 cut(s) 199
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
SaqAI TTAA 2 cut(s) 63, 265
Sau3AI GATC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 201
SetI ASST 1 cut(s) 72
SfaNI GCATC 2 cut(s) 10, 32
Sse9I AATT 1 cut(s) 254
SspMI CTAG 1 cut(s) 177
StyD4I CCNGG 1 cut(s) 199
StyI CCWWGG 1 cut(s) 181
TaqI TCGA 2 cut(s) 134, 193
TasI AATT 1 cut(s) 254
TfiI GAWTC 2 cut(s) 44, 156
Tru1I TTAA 2 cut(s) 63, 265
Tru9I TTAA 2 cut(s) 63, 265
TspDTI ATGAA 1 cut(s) 266
Van91I CCANNNNNTGG 1 cut(s) 40
XagI CCTNNNNNAGG 1 cut(s) 185
XapI RAATTY 1 cut(s) 254
XspI CTAG 1 cut(s) 177
Zsp2I ATGCAT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.