RchiOBHm_Chr7g0243741

Amino-acid permease

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
69976490 .. 69980239
3750 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21845

Sequence Viewer

Length: 243 bp
ATGGGACAGAACCAAGTAGATGCATCACAAATCCAAGAGATGGATTCAGGGGAAAAGCGACTTAATGAGCTTGGTTACAAGCAAGAACTCAGAAGAGAGATGACTTTGTTCAAAACTCTTGCAATATCATTCTCGACGATGACACTCTTCACCAGAATCACTCCTTTGTATGGTTCTAGCCTTGTATATGCAGGTCCTGCAAGCCTTGTGTGGGGTTGGGTGGTAGTATCATTTTTCACCTGA

Protein Analysis

80

Amino Acids

9.07

Weight (kDa)

6.13

Isoelectric Point (pI)

32.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 182
AccB7I CCANNNNNTGG 1 cut(s) 40
AfiI CCNNNNNNNGG 3 cut(s) 40, 170, 211
AgsI TTSAA 1 cut(s) 112
AluBI AGCT 1 cut(s) 70
AluI AGCT 1 cut(s) 70
AlwNI CAGNNNCTG 1 cut(s) 197
AspS9I GGNCC 1 cut(s) 194
AsuHPI GGTGA 2 cut(s) 142, 229
AvaII GGWCC 1 cut(s) 194
BccI CCATC 1 cut(s) 34
BfaI CTAG 1 cut(s) 177
BfuAI ACCTGC 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 194
BmgT120I GGNCC 1 cut(s) 194
BmsI GCATC 2 cut(s) 10, 32
Bsc4I CCNNNNNNNGG 3 cut(s) 40, 170, 211
BseLI CCNNNNNNNGG 3 cut(s) 40, 170, 211
BseMII CTCAG 1 cut(s) 103
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 3 cut(s) 40, 170, 211
BsmFI GGGAC 1 cut(s) 18
BspCNI CTCAG 1 cut(s) 102
BspMI ACCTGC 1 cut(s) 182
Bst6I CTCTTC 2 cut(s) 88, 152
BstAPI GCANNNNNTGC 1 cut(s) 197
BstC8I GCNNGC 1 cut(s) 202
BstDEI CTNAG 1 cut(s) 89
BstMWI GCNNNNNNNGC 1 cut(s) 197
BveI ACCTGC 1 cut(s) 182
Cac8I GCNNGC 1 cut(s) 202
CaiI CAGNNNCTG 1 cut(s) 197
Cfr13I GGNCC 1 cut(s) 194
CviJI RGCY 3 cut(s) 70, 180, 204
CviKI_1 RGCY 3 cut(s) 70, 180, 204
DdeI CTNAG 1 cut(s) 89
Eam1104I CTCTTC 2 cut(s) 88, 152
EarI CTCTTC 2 cut(s) 88, 152
Eco47I GGWCC 1 cut(s) 194
EcoO109I RGGNCCY 1 cut(s) 194
EcoT22I ATGCAT 1 cut(s) 25
FaiI YATR 3 cut(s) 171, 187, 189
FaqI GGGAC 1 cut(s) 18
FspBI CTAG 1 cut(s) 177
HinfI GANTC 2 cut(s) 44, 156
HphI GGTGA 2 cut(s) 142, 229
Hpy188I TCNGA 1 cut(s) 92
Hpy188III TCNNGA 1 cut(s) 133
Hpy99I CGWCG 1 cut(s) 139
HpyCH4V TGCA 4 cut(s) 23, 122, 191, 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 89
LpnPI CCDG 4 cut(s) 33, 166, 177, 210
LweI GCATC 2 cut(s) 10, 32
MaeI CTAG 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 74
MboII GAAGA 2 cut(s) 105, 139
Mph1103I ATGCAT 1 cut(s) 25
MseI TTAA 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 197
NsiI ATGCAT 1 cut(s) 25
PfeI GAWTC 2 cut(s) 44, 156
PflMI CCANNNNNTGG 1 cut(s) 40
PpuMI RGGWCCY 1 cut(s) 194
Psp5II RGGWCCY 1 cut(s) 194
PspPI GGNCC 1 cut(s) 194
PspPPI RGGWCCY 1 cut(s) 194
PstNI CAGNNNCTG 1 cut(s) 197
SaqAI TTAA 1 cut(s) 63
Sau96I GGNCC 1 cut(s) 194
SetI ASST 3 cut(s) 72, 196, 242
SfaNI GCATC 2 cut(s) 10, 32
SinI GGWCC 1 cut(s) 194
SspMI CTAG 1 cut(s) 177
TaqI TCGA 1 cut(s) 134
TfiI GAWTC 2 cut(s) 44, 156
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
Van91I CCANNNNNTGG 1 cut(s) 40
VpaK11BI GGWCC 1 cut(s) 194
XspI CTAG 1 cut(s) 177
Zsp2I ATGCAT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.