Rh1AG013600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
2171546 .. 2172109
564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG013600.1

Sequence Viewer

Length: 294 bp
ATGGAGCATTCTAGTACATATATCACACAACGCACATCAATCAACACACTGCACAATATTTTGCGGTCACTCCCAAGCTTTCTTTCCCAAAGGAGACTGTTGGTTGCTGACTCAGATTCAGACCCAGAAAAAGGAAAGGAAAGGAGACCTGGTTTTATTTTGCTCGGCAGTGCAACTCTGCTCATTTGGCCTCTCTATTCACTAAGACCTCAGAGCTTGTTCCCATCTACACAGTTAGACTCTGATCTTATCTGGGCCTTTCTCAAAATCAAGATCTTGTTCCCAAGCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.1

Weight (kDa)

9.69

Isoelectric Point (pI)

66.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 64
AfaI GTAC 1 cut(s) 16
AfiI CCNNNNNNNGG 1 cut(s) 131
AjnI CCWGG 1 cut(s) 148
AjuI GAANNNNNNNTTGG 2 cut(s) 67, 99
AluBI AGCT 2 cut(s) 78, 216
AluI AGCT 2 cut(s) 78, 216
Alw26I GTCTC 2 cut(s) 88, 139
AoxI GGCC 2 cut(s) 188, 255
AspS9I GGNCC 1 cut(s) 255
BccI CCATC 1 cut(s) 232
BciT130I CCWGG 1 cut(s) 150
BcoDI GTCTC 2 cut(s) 88, 139
BfaI CTAG 1 cut(s) 12
BglII AGATCT 1 cut(s) 273
Bme1390I CCNGG 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 255
BmrFI CCNGG 1 cut(s) 150
BsaI GGTCTC 1 cut(s) 139
BsaXI ACNNNNNCTCC 2 cut(s) 136, 166
Bsc4I CCNNNNNNNGG 1 cut(s) 131
BseBI CCWGG 1 cut(s) 150
BseLI CCNNNNNNNGG 1 cut(s) 131
BseMII CTCAG 2 cut(s) 126, 224
BsgI GTGCAG 1 cut(s) 35
BshFI GGCC 2 cut(s) 190, 257
BslI CCNNNNNNNGG 1 cut(s) 131
BsmAI GTCTC 2 cut(s) 88, 139
BsmI GAATGC 1 cut(s) 7
BsnI GGCC 2 cut(s) 190, 257
Bso31I GGTCTC 1 cut(s) 139
Bsp143I GATC 2 cut(s) 244, 273
BspACI CCGC 1 cut(s) 64
BspANI GGCC 2 cut(s) 190, 257
BspCNI CTCAG 2 cut(s) 125, 223
BspTNI GGTCTC 1 cut(s) 139
BssMI GATC 2 cut(s) 244, 273
Bst2UI CCWGG 1 cut(s) 150
Bst4CI ACNGT 2 cut(s) 99, 234
BstDEI CTNAG 3 cut(s) 112, 203, 210
BstKTI GATC 2 cut(s) 247, 276
BstMAI GTCTC 2 cut(s) 88, 139
BstMBI GATC 2 cut(s) 244, 273
BstMWI GCNNNNNNNGC 1 cut(s) 187
BstNI CCWGG 1 cut(s) 150
BstSCI CCNGG 1 cut(s) 148
BstX2I RGATCY 1 cut(s) 273
BstYI RGATCY 1 cut(s) 273
BsuRI GGCC 2 cut(s) 190, 257
BtsI GCAGTG 2 cut(s) 47, 175
BtsIMutI CAGTG 2 cut(s) 47, 175
Cfr13I GGNCC 1 cut(s) 255
CsiI ACCWGGT 1 cut(s) 148
Csp6I GTAC 1 cut(s) 15
CviJI RGCY 4 cut(s) 78, 190, 216, 257
CviKI_1 RGCY 4 cut(s) 78, 190, 216, 257
CviQI GTAC 1 cut(s) 15
DdeI CTNAG 3 cut(s) 112, 203, 210
DpnI GATC 2 cut(s) 246, 275
DpnII GATC 2 cut(s) 244, 273
Eco31I GGTCTC 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 148
FaiI YATR 4 cut(s) 19, 21, 290, 292
FauNDI CATATG 1 cut(s) 290
FspBI CTAG 1 cut(s) 12
HaeIII GGCC 2 cut(s) 190, 257
HindIII AAGCTT 1 cut(s) 76
HinfI GANTC 3 cut(s) 110, 116, 239
Hpy188I TCNGA 4 cut(s) 115, 121, 213, 244
Hpy188III TCNNGA 1 cut(s) 271
HpyCH4III ACNGT 2 cut(s) 99, 234
HpyCH4V TGCA 2 cut(s) 52, 173
HpyF10VI GCNNNNNNNGC 1 cut(s) 187
HpyF3I CTNAG 3 cut(s) 112, 203, 210
Kzo9I GATC 2 cut(s) 244, 273
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 4 cut(s) 135, 138, 162, 238
MabI ACCWGGT 1 cut(s) 148
MaeI CTAG 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 66
MalI GATC 2 cut(s) 246, 275
MboI GATC 2 cut(s) 244, 273
MflI RGATCY 1 cut(s) 273
MlyI GAGTC 2 cut(s) 104, 233
MnlI CCTC 2 cut(s) 201, 219
MspR9I CCNGG 1 cut(s) 150
Mva1269I GAATGC 1 cut(s) 7
MvaI CCWGG 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 187
NdeI CATATG 1 cut(s) 290
NdeII GATC 2 cut(s) 244, 273
NmeAIII GCCGAG 1 cut(s) 144
NmuCI GTSAC 1 cut(s) 66
PctI GAATGC 1 cut(s) 7
PfeI GAWTC 1 cut(s) 116
PleI GAGTC 2 cut(s) 104, 233
PpsI GAGTC 2 cut(s) 104, 233
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
PspPI GGNCC 1 cut(s) 255
PsuI RGATCY 1 cut(s) 273
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
Sau3AI GATC 2 cut(s) 244, 273
Sau96I GGNCC 1 cut(s) 255
SchI GAGTC 2 cut(s) 104, 233
ScrFI CCNGG 1 cut(s) 150
SetI ASST 4 cut(s) 80, 151, 211, 218
SexAI ACCWGGT 1 cut(s) 148
SsiI CCGC 1 cut(s) 64
SspI AATATT 1 cut(s) 58
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 148
TaaI ACNGT 2 cut(s) 99, 234
TatI WGTACW 1 cut(s) 14
TfiI GAWTC 1 cut(s) 116
TscAI CASTG 2 cut(s) 54, 175
TseFI GTSAC 1 cut(s) 66
Tsp45I GTSAC 1 cut(s) 66
TspRI CASTG 2 cut(s) 54, 175
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.