RchiOBHm_Chr3g0480291

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
26049403 .. 26049960
558 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44531

Sequence Viewer

Length: 210 bp
ATGTTTAGAATGTTAATAGTTATCAGTCTCTTAGTTGGGTTTGAAGTGCAGATGAGGTCAGATTATATAGTTTTGATCTGGACTGAGCAGAGCAATAGCCATTTGCCATTCAAAAGACAGACAAGTAGTAACTCCAGCAGGTATGCTCGTTTTGTGTCTGCCACCCTATTTTTATTGCTTATATTTTTGTGCATTTCATTGTTCCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.09

Weight (kDa)

9.77

Isoelectric Point (pI)

42.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 129
AgsI TTSAA 2 cut(s) 44, 112
Alw26I GTCTC 1 cut(s) 32
BcoDI GTCTC 1 cut(s) 32
BfuAI ACCTGC 1 cut(s) 129
BpmI CTGGAG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 75
BsgI GTGCAG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 76
BspMI ACCTGC 1 cut(s) 129
BssMI GATC 1 cut(s) 75
BstDEI CTNAG 2 cut(s) 31, 84
BstKTI GATC 1 cut(s) 78
BstMAI GTCTC 1 cut(s) 32
BstMBI GATC 1 cut(s) 75
BveI ACCTGC 1 cut(s) 129
CviJI RGCY 1 cut(s) 99
CviKI_1 RGCY 1 cut(s) 99
DdeI CTNAG 2 cut(s) 31, 84
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
FaiI YATR 4 cut(s) 66, 68, 144, 182
GsuI CTGGAG 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 79
HpyCH4V TGCA 2 cut(s) 49, 192
HpyF3I CTNAG 2 cut(s) 31, 84
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 3 cut(s) 64, 124, 148
MaeIII GTNAC 1 cut(s) 128
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MnlI CCTC 1 cut(s) 48
MseI TTAA 1 cut(s) 14
NdeII GATC 1 cut(s) 75
SaqAI TTAA 1 cut(s) 14
Sau3AI GATC 1 cut(s) 75
SetI ASST 2 cut(s) 59, 143
SgeI CNNG 5 cut(s) 91, 135, 147, 151, 159
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TspDTI ATGAA 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.