RchiOBHm_Chr4g0423111
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
48722684 .. 48723540
857 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39253

Sequence Viewer

Length: 234 bp
ATGCAGTATGTTTTTGTTCATTACCTTATGTTGTTCCCTGATGGCACACTTCGCAGGTATTTCAAAGGTTCTGAGCTTCTTGTTGATTTACAAGATTATGACTATTCTTTGGACTTGTGGAGTCTTAGTTGTATGTTTCCTGGAATGCCATTTTTTTATGGACTTGATAACTATGATCAGCTAGTGAAAATAGCAAAGGAGGCTTGCAACAACACTAGAGTAATTGGTTCGTGA

Protein Analysis

77

Amino Acids

9.06

Weight (kDa)

4.7

Isoelectric Point (pI)

61.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 45
AgsI TTSAA 1 cut(s) 64
AjnI CCWGG 1 cut(s) 139
AluBI AGCT 2 cut(s) 76, 181
AluI AGCT 2 cut(s) 76, 181
BccI CCATC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 141
BclI TGATCA 1 cut(s) 175
BfaI CTAG 2 cut(s) 182, 216
BfuAI ACCTGC 1 cut(s) 45
Bme1390I CCNGG 1 cut(s) 141
BmrFI CCNGG 1 cut(s) 141
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
BseBI CCWGG 1 cut(s) 141
BseMII CTCAG 1 cut(s) 63
BsmI GAATGC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 175
BspCNI CTCAG 1 cut(s) 64
BspMI ACCTGC 1 cut(s) 45
BssMI GATC 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 141
BstC8I GCNNGC 1 cut(s) 205
BstDEI CTNAG 2 cut(s) 72, 125
BstKTI GATC 1 cut(s) 178
BstMBI GATC 1 cut(s) 175
BstMWI GCNNNNNNNGC 2 cut(s) 51, 200
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BveI ACCTGC 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 205
CviJI RGCY 3 cut(s) 76, 181, 203
CviKI_1 RGCY 3 cut(s) 76, 181, 203
DdeI CTNAG 2 cut(s) 72, 125
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
EcoRII CCWGG 1 cut(s) 139
FaiI YATR 6 cut(s) 9, 29, 99, 134, 159, 174
FbaI TGATCA 1 cut(s) 175
FspBI CTAG 2 cut(s) 182, 216
HinfI GANTC 1 cut(s) 121
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 231
HpyCH4V TGCA 2 cut(s) 4, 207
HpyF10VI GCNNNNNNNGC 2 cut(s) 51, 200
HpyF3I CTNAG 2 cut(s) 72, 125
Ksp22I TGATCA 1 cut(s) 175
Kzo9I GATC 1 cut(s) 175
LpnPI CCDG 4 cut(s) 40, 51, 126, 153
MaeI CTAG 2 cut(s) 182, 216
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MluCI AATT 1 cut(s) 222
MlyI GAGTC 1 cut(s) 130
MnlI CCTC 1 cut(s) 193
MspR9I CCNGG 1 cut(s) 141
Mva1269I GAATGC 1 cut(s) 150
MvaI CCWGG 1 cut(s) 141
MwoI GCNNNNNNNGC 2 cut(s) 51, 200
NdeII GATC 1 cut(s) 175
PctI GAATGC 1 cut(s) 150
PfoI TCCNGGA 1 cut(s) 139
PleI GAGTC 1 cut(s) 129
PpsI GAGTC 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
Sau3AI GATC 1 cut(s) 175
SchI GAGTC 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 141
SetI ASST 5 cut(s) 27, 59, 70, 78, 183
Sse9I AATT 1 cut(s) 222
SspMI CTAG 2 cut(s) 182, 216
StyD4I CCNGG 1 cut(s) 139
TasI AATT 1 cut(s) 222
TspDTI ATGAA 1 cut(s) 8
XspI CTAG 2 cut(s) 182, 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.