Rh4AG243500
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
55237278 .. 55252449
15172 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG243500.1

Sequence Viewer

Length: 240 bp
ATGCATTATGCTTTTGTTCATTACCTTATGTTGTTCCCTGATGGCACACTTCACAAGTATTTCAAAGGTTCTGAGTTTCTTGTTGATTTACAAGATTATGACTATTCTTTGGACTTGTGGAGTCTTGGTTGTATGTTTCCTGGAATGATATTTCGTAAGAAGCCATTTTTTTATGGACGTGATAACTATGATCAGCTAGTGAAAATAGCAAAGGAGGCTGATTGTCAAGCTAATGCATAG

Protein Analysis

79

Amino Acids

9.38

Weight (kDa)

5.79

Isoelectric Point (pI)

55.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 64
AjiI CACGTC 1 cut(s) 179
AjnI CCWGG 1 cut(s) 139
AluBI AGCT 2 cut(s) 196, 230
AluI AGCT 2 cut(s) 196, 230
BccI CCATC 1 cut(s) 35
BciT130I CCWGG 1 cut(s) 141
BclI TGATCA 1 cut(s) 190
BfaI CTAG 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 141
BmgBI CACGTC 1 cut(s) 179
BmrFI CCNGG 1 cut(s) 141
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
BseBI CCWGG 1 cut(s) 141
BseMII CTCAG 1 cut(s) 63
Bsp143I GATC 1 cut(s) 190
BspCNI CTCAG 1 cut(s) 64
BssMI GATC 1 cut(s) 190
Bst2UI CCWGG 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 72
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BtrI CACGTC 1 cut(s) 179
CviJI RGCY 4 cut(s) 163, 196, 218, 230
CviKI_1 RGCY 4 cut(s) 163, 196, 218, 230
DdeI CTNAG 1 cut(s) 72
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
EcoRII CCWGG 1 cut(s) 139
EcoT22I ATGCAT 2 cut(s) 6, 238
FaiI YATR 7 cut(s) 9, 29, 99, 134, 174, 189, 238
FbaI TGATCA 1 cut(s) 190
FspBI CTAG 1 cut(s) 197
HinfI GANTC 1 cut(s) 121
Hpy188I TCNGA 1 cut(s) 73
HpyCH4IV ACGT 1 cut(s) 178
HpyCH4V TGCA 2 cut(s) 4, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpyF3I CTNAG 1 cut(s) 72
HpySE526I ACGT 1 cut(s) 178
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 3 cut(s) 51, 126, 153
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 178
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MlyI GAGTC 1 cut(s) 130
MnlI CCTC 1 cut(s) 208
Mph1103I ATGCAT 2 cut(s) 6, 238
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeII GATC 1 cut(s) 190
NsiI ATGCAT 2 cut(s) 6, 238
PfoI TCCNGGA 1 cut(s) 139
PleI GAGTC 1 cut(s) 129
PpsI GAGTC 1 cut(s) 129
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
Sau3AI GATC 1 cut(s) 190
SchI GAGTC 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 141
SetI ASST 5 cut(s) 27, 70, 181, 198, 232
SspMI CTAG 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 139
TaiI ACGT 1 cut(s) 181
TspDTI ATGAA 1 cut(s) 8
XspI CTAG 1 cut(s) 197
Zsp2I ATGCAT 2 cut(s) 6, 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.