Rmu_sc0028958.1_g000001

CAAX prenyl protease 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028958.1
Physical Location & Seq
Forward (+)
1 .. 926
926 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028958.1_g000001.1.cds

Sequence Viewer

Length: 369 bp
atccgtatgcatttacacttcgggggatatgctctcctgagaaactccagcagtctgtttctaagttttgggtttgatactcaaccagtaatcattggtctcatcatatttcagcataccataacacctatccagcacctagtacactttgcttgcaaccttgtgagccgagcttttgaatttcaggctgatgcttttgctaagaaacttggttatgcttcttcgcttcgagctagtcttgttagactacaggaagagaatttgtcagctatgaatactgatccttggtactcggcatatcactattctcatccccctctagtcgaaaggttggctgcaattggtgaaacagacaagaaagcagactga

Protein Analysis

122

Amino Acids

13.75

Weight (kDa)

7.23

Isoelectric Point (pI)

40.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 275
AcsI RAATTY 2 cut(s) 179, 259
AfaI GTAC 2 cut(s) 144, 290
AgsI TTSAA 1 cut(s) 179
AluBI AGCT 3 cut(s) 173, 233, 269
AluI AGCT 3 cut(s) 173, 233, 269
Alw26I GTCTC 1 cut(s) 104
AlwI GGATC 1 cut(s) 275
ApeKI GCWGC 1 cut(s) 335
ApoI RAATTY 2 cut(s) 179, 259
AsuHPI GGTGA 1 cut(s) 356
BbvI GCAGC 1 cut(s) 322
BcoDI GTCTC 1 cut(s) 104
BfaI CTAG 3 cut(s) 140, 234, 320
BfmI CTRYAG 1 cut(s) 248
BisI GCNGC 1 cut(s) 336
BlsI GCNGC 1 cut(s) 337
BmsI GCATC 1 cut(s) 181
BpmI CTGGAG 1 cut(s) 31
BsaI GGTCTC 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 284
Bse1I ACTGG 1 cut(s) 86
BseDI CCNNGG 1 cut(s) 284
BseGI GGATG 1 cut(s) 310
BseMII CTCAG 1 cut(s) 29
BseNI ACTGG 1 cut(s) 86
BseXI GCAGC 1 cut(s) 322
BsmAI GTCTC 1 cut(s) 104
Bso31I GGTCTC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 280
BspCNI CTCAG 1 cut(s) 30
BspPI GGATC 1 cut(s) 275
BspTNI GGTCTC 1 cut(s) 104
BsrI ACTGG 1 cut(s) 86
BssECI CCNNGG 1 cut(s) 284
BssMI GATC 1 cut(s) 280
BssT1I CCWWGG 1 cut(s) 284
Bst6I CTCTTC 1 cut(s) 249
BstC8I GCNNGC 1 cut(s) 154
BstDEI CTNAG 3 cut(s) 38, 62, 201
BstF5I GGATG 1 cut(s) 310
BstKTI GATC 1 cut(s) 283
BstMAI GTCTC 1 cut(s) 104
BstMBI GATC 1 cut(s) 280
BstSFI CTRYAG 1 cut(s) 248
BstV1I GCAGC 1 cut(s) 322
BtsCI GGATG 1 cut(s) 310
Cac8I GCNNGC 1 cut(s) 154
Csp6I GTAC 2 cut(s) 143, 289
CviJI RGCY 6 cut(s) 168, 173, 188, 233, 269, 335
CviKI_1 RGCY 6 cut(s) 168, 173, 188, 233, 269, 335
CviQI GTAC 2 cut(s) 143, 289
DdeI CTNAG 3 cut(s) 38, 62, 201
DpnI GATC 1 cut(s) 282
DpnII GATC 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 284
Eco31I GGTCTC 1 cut(s) 104
EcoT14I CCWWGG 1 cut(s) 284
EcoT22I ATGCAT 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 284
FaiI YATR 8 cut(s) 8, 30, 107, 117, 122, 216, 272, 298
Fnu4HI GCNGC 1 cut(s) 336
FokI GGATG 1 cut(s) 297
Fsp4HI GCNGC 1 cut(s) 336
FspBI CTAG 3 cut(s) 140, 234, 320
GluI GCNGC 1 cut(s) 336
GsuI CTGGAG 1 cut(s) 31
HphI GGTGA 1 cut(s) 356
Hpy166II GTNNAC 1 cut(s) 145
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 145
HpyCH4V TGCA 3 cut(s) 10, 156, 338
HpyF3I CTNAG 3 cut(s) 38, 62, 201
Kzo9I GATC 1 cut(s) 280
LpnPI CCDG 6 cut(s) 50, 61, 99, 146, 170, 236
Lsp1109I GCAGC 1 cut(s) 322
LweI GCATC 1 cut(s) 181
MaeI CTAG 3 cut(s) 140, 234, 320
MalI GATC 1 cut(s) 282
MboI GATC 1 cut(s) 280
MboII GAAGA 2 cut(s) 213, 266
MfeI CAATTG 1 cut(s) 339
MluCI AATT 3 cut(s) 179, 259, 339
MnlI CCTC 1 cut(s) 327
Mph1103I ATGCAT 1 cut(s) 12
MunI CAATTG 1 cut(s) 339
NdeII GATC 1 cut(s) 280
NmeAIII GCCGAG 2 cut(s) 194, 272
NsiI ATGCAT 1 cut(s) 12
PkrI GCNGC 1 cut(s) 337
RsaI GTAC 2 cut(s) 144, 290
RsaNI GTAC 2 cut(s) 143, 289
SatI GCNGC 1 cut(s) 336
Sau3AI GATC 1 cut(s) 280
SetI ASST 7 cut(s) 130, 141, 162, 175, 235, 271, 332
SfaNI GCATC 1 cut(s) 181
SfcI CTRYAG 1 cut(s) 248
Sse9I AATT 3 cut(s) 179, 259, 339
SspMI CTAG 3 cut(s) 140, 234, 320
StyI CCWWGG 1 cut(s) 284
TaqI TCGA 2 cut(s) 229, 324
TasI AATT 3 cut(s) 179, 259, 339
TatI WGTACW 1 cut(s) 142
TseI GCWGC 1 cut(s) 335
TspDTI ATGAA 1 cut(s) 287
XapI RAATTY 2 cut(s) 179, 259
XspI CTAG 3 cut(s) 140, 234, 320
Zsp2I ATGCAT 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.