Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0002736

Physical Location & Seq

Genomic Coordinates Reverse (-)

78490124 .. 78493010

Gene Structure 2887 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ34747

Sequence Viewer

CDS Protein Promoter (2k)

Length: 921 bp

ATGAGAAGAACTACAGTAGATCTCCTTCATGTCCTCGTTACAAGCGGGGTTCTAATGAGAGTGCTTCTGAGACTAAACGGTTTTCTCCCAAGGAGAGAAGTGCAAAAGTTTAATAACTTCGGCAATGAAAAGAATAATAGTAGGTTTCCTTCTCGTCCCTGTTCTAAGTGGGGTTCTGATGGATTAGCGAATGCTTCTGAAACTAAACGTTTTTCTCCCAAGGTTAGAAGTGCAAAAGTTTACAATGAAACAAAATTTAAGGAGGCTGATAATTTTGGTAATATTAAGAGTAGCAGTAGATCTACTTTGCGTCCTCGCTCTACATGGGGTTCTGATAAGCAATGTTCTGAAACTAAACGTTTTTCTCCTAAGGTTAGAAGTGAGAAACGTTCCAATAAAACCAAAGTTAAGGATGATGATAAGATGGAATCCATTACAACTGATGATGGTCGGAGTGCTTCACTGAAGAAACATAACCAAATAAAACCAGACTTGCAAAAATCCCCAAATATATCTCTTCCAAATACTGTGAAGAAAAAAGCACGGAACAAGAATATCTCGGATGAAGGATCAGAGGTGCTAGATGGTCAGCCAAAGAACAAGAAGCAAATGCGACTAGATCCATACGACATTTCAAATAAACGTCTTGATGATAATATTGCTACAAATGGTCAAAAACTTAAAGGAAAGGAAAACGATGTTGAGGAAAACGCTGAGATATCAAAGAACGTACAATTTCGTGCAATCCAACCATGTCCGTCAATCCTCTCCTATGTCGAAGATAATTTGTTGGGTCATAGACGCTTGATTGAACTGAAGAGGCCAGGCTACAACACTGAGCTTTCTGCACCATTGGATAATACTCCTTTCTCTATCAGCTCCGAAAGAGTTTTGAGGAAAATGTATGTAATGCAAGTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MMR_HSR1

Protein Analysis

306

Amino Acids

34.92

Weight (kDa)

10.0

Isoelectric Point (pI)

58.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002736)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G58370 AT5G58370 AT5G58370
fragaria_vesca	FvH4_3g40250 FvH4_3g40250
malus_domestica	MD03G1054800.v1.1
prunus_persica	Prupe.6G043400_v2.0.a1
pyrus_communis	pycom03g04350
rosa_chinensis	RchiOBHm_Chr5g0072471 RchiOBHm_Chr5g0072511 RchiOBHm_Chr5g0073721
rosa_laevigata	RLG00000036302 RLG00000036304 RLG00000036308
rosa_multiflora	Rmu_sc0004501.1_g000007 Rmu_sc0004594.1_g000018 Rmu_sc0008676.1_g000008 Rmu_sc0008676.1_g000023 Rmu_sc0009248.1_g000009
rosa_roxburghii	Rroxscaffold_1G00007580 Rroxscaffold_1G00008640 Rroxscaffold_1G00008730
rosa_rugosa	Rorug05G0418400 Rorug05G0430400
rosa_samantha	Rh5AG475000 Rh5AG483100 Rh5BG495000 Rh5BG495400 Rh5BG504100 Rh5CG518900 Rh5CG519200 Rh5CG527600 Rh5DG507100 Rh5DG507400 Rh5DG516200
rosa_wichuraiana	Rw5G044100 Rw5G044130 Rw5G044890 Rw5G044910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	45
AclI	AACGTT	3 cut(s)	208, 358, 388
AclWI	GGATC	2 cut(s)	577, 614
AcsI	RAATTY	1 cut(s)	254
AcuI	CTGAAG	2 cut(s)	485, 836
AfaI	GTAC	1 cut(s)	732
AgsI	TTSAA	2 cut(s)	636, 812
AjnI	CCWGG	1 cut(s)	823
AluBI	AGCT	2 cut(s)	841, 879
AluI	AGCT	2 cut(s)	841, 879
Alw26I	GTCTC	1 cut(s)	64
AlwI	GGATC	2 cut(s)	577, 614
AoxI	GGCC	1 cut(s)	821
ApoI	RAATTY	1 cut(s)	254
AxyI	CCTNAGG	1 cut(s)	369
BarI	GAAGNNNNNNTAC	4 cut(s)	9, 41, 133, 165
BccI	CCATC	4 cut(s)	173, 418, 440, 578
BciT130I	CCWGG	1 cut(s)	825
BcoDI	GTCTC	1 cut(s)	64
BfaI	CTAG	3 cut(s)	581, 617, 919
BfmI	CTRYAG	1 cut(s)	12
BglII	AGATCT	2 cut(s)	19, 299
Bme1390I	CCNGG	1 cut(s)	825
BmrFI	CCNGG	1 cut(s)	825
BsaJI	CCNNGG	2 cut(s)	89, 219
Bse21I	CCTNAGG	1 cut(s)	369
Bse3DI	GCAATG	2 cut(s)	130, 347
BseBI	CCWGG	1 cut(s)	825
BseDI	CCNNGG	2 cut(s)	89, 219
BseGI	GGATG	2 cut(s)	418, 568
BseMI	GCAATG	2 cut(s)	130, 347
BseMII	CTCAG	3 cut(s)	59, 705, 828
BsgI	GTGCAG	1 cut(s)	831
BshFI	GGCC	1 cut(s)	823
BslFI	GGGAC	1 cut(s)	141
BsmAI	GTCTC	1 cut(s)	64
BsmFI	GGGAC	1 cut(s)	141
BsmI	GAATGC	1 cut(s)	196
BsnI	GGCC	1 cut(s)	823
Bsp143I	GATC	4 cut(s)	19, 299, 569, 619
BspACI	CCGC	1 cut(s)	45
BspANI	GGCC	1 cut(s)	823
BspCNI	CTCAG	3 cut(s)	60, 706, 829
BspPI	GGATC	2 cut(s)	577, 614
BsrDI	GCAATG	2 cut(s)	130, 347
BssECI	CCNNGG	2 cut(s)	89, 219
BssMI	GATC	4 cut(s)	19, 299, 569, 619
BssT1I	CCWWGG	2 cut(s)	89, 219
Bst2UI	CCWGG	1 cut(s)	825
Bst4CI	ACNGT	3 cut(s)	16, 80, 529
Bst6I	CTCTTC	2 cut(s)	522, 812
BstDEI	CTNAG	5 cut(s)	68, 165, 369, 714, 837
BstF5I	GGATG	2 cut(s)	418, 568
BstKTI	GATC	4 cut(s)	22, 302, 572, 622
BstMAI	GTCTC	1 cut(s)	64
BstMBI	GATC	4 cut(s)	19, 299, 569, 619
BstNI	CCWGG	1 cut(s)	825
BstSCI	CCNGG	1 cut(s)	823
BstSFI	CTRYAG	1 cut(s)	12
BstX2I	RGATCY	3 cut(s)	19, 299, 619
BstYI	RGATCY	3 cut(s)	19, 299, 619
Bsu36I	CCTNAGG	1 cut(s)	369
BsuRI	GGCC	1 cut(s)	823
BtsCI	GGATG	2 cut(s)	418, 568
BtsIMutI	CAGTG	2 cut(s)	461, 834
CseI	GACGC	2 cut(s)	299, 810
Csp6I	GTAC	1 cut(s)	731
CviAII	CATG	3 cut(s)	29, 324, 753
CviJI	RGCY	6 cut(s)	266, 592, 823, 828, 841, 879
CviKI_1	RGCY	6 cut(s)	266, 592, 823, 828, 841, 879
CviQI	GTAC	1 cut(s)	731
DdeI	CTNAG	5 cut(s)	68, 165, 369, 714, 837
DpnI	GATC	4 cut(s)	21, 301, 571, 621
DpnII	GATC	4 cut(s)	19, 299, 569, 619
Eam1104I	CTCTTC	2 cut(s)	522, 812
EarI	CTCTTC	2 cut(s)	522, 812
Eco130I	CCWWGG	2 cut(s)	89, 219
Eco32I	GATATC	1 cut(s)	720
Eco57I	CTGAAG	2 cut(s)	485, 836
Eco81I	CCTNAGG	1 cut(s)	369
EcoRII	CCWGG	1 cut(s)	823
EcoRV	GATATC	1 cut(s)	720
EcoT14I	CCWWGG	2 cut(s)	89, 219
ErhI	CCWWGG	2 cut(s)	89, 219
FaeI	CATG	3 cut(s)	32, 327, 756
FaiI	YATR	9 cut(s)	30, 325, 474, 512, 625, 754, 774, 798, 906
FaqI	GGGAC	1 cut(s)	141
FatI	CATG	3 cut(s)	28, 323, 752
FauI	CCCGC	1 cut(s)	38
FokI	GGATG	2 cut(s)	425, 575
FspBI	CTAG	3 cut(s)	581, 617, 919
HaeIII	GGCC	1 cut(s)	823
HgaI	GACGC	2 cut(s)	299, 810
Hin1II	CATG	3 cut(s)	32, 327, 756
HinfI	GANTC	1 cut(s)	428
Hpy166II	GTNNAC	1 cut(s)	241
Hpy188I	TCNGA	9 cut(s)	69, 178, 199, 334, 349, 453, 562, 574, 883
Hpy188III	TCNNGA	1 cut(s)	647
Hpy8I	GTNNAC	1 cut(s)	241
HpyAV	CCTTC	3 cut(s)	35, 159, 560
HpyCH4III	ACNGT	3 cut(s)	16, 80, 529
HpyCH4IV	ACGT	5 cut(s)	208, 358, 388, 643, 729
HpyCH4V	TGCA	6 cut(s)	103, 233, 496, 743, 848, 913
HpyF3I	CTNAG	5 cut(s)	68, 165, 369, 714, 837
HpySE526I	ACGT	5 cut(s)	208, 358, 388, 643, 729
Hsp92II	CATG	3 cut(s)	32, 327, 756
Kzo9I	GATC	4 cut(s)	19, 299, 569, 619
LmnI	GCTCC	1 cut(s)	884
LpnPI	CCDG	4 cut(s)	172, 501, 810, 837
MaeI	CTAG	3 cut(s)	581, 617, 919
MaeII	ACGT	5 cut(s)	208, 358, 388, 643, 729
MaeIII	GTNAC	1 cut(s)	37
MalI	GATC	4 cut(s)	21, 301, 571, 621
MboI	GATC	4 cut(s)	19, 299, 569, 619
MboII	GAAGA	6 cut(s)	18, 478, 509, 544, 791, 829
MflI	RGATCY	3 cut(s)	19, 299, 619
MluCI	AATT	4 cut(s)	254, 271, 734, 784
MmeI	TCCRAC	2 cut(s)	431, 772
MnlI	CCTC	8 cut(s)	44, 256, 324, 568, 697, 776, 813, 888
MseI	TTAA	5 cut(s)	111, 258, 285, 408, 681
MspR9I	CCNGG	1 cut(s)	825
Mva1269I	GAATGC	1 cut(s)	196
MvaI	CCWGG	1 cut(s)	825
NdeII	GATC	4 cut(s)	19, 299, 569, 619
NlaIII	CATG	3 cut(s)	32, 327, 756
PctI	GAATGC	1 cut(s)	196
PfeI	GAWTC	1 cut(s)	428
Psp1406I	AACGTT	3 cut(s)	208, 358, 388
Psp6I	CCWGG	1 cut(s)	823
PspGI	CCWGG	1 cut(s)	823
PsuI	RGATCY	3 cut(s)	19, 299, 619
RsaI	GTAC	1 cut(s)	732
RsaNI	GTAC	1 cut(s)	731
SaqAI	TTAA	5 cut(s)	111, 258, 285, 408, 681
Sau3AI	GATC	4 cut(s)	19, 299, 569, 619
ScrFI	CCNGG	1 cut(s)	825
SfcI	CTRYAG	1 cut(s)	12
Sse9I	AATT	4 cut(s)	254, 271, 734, 784
SsiI	CCGC	1 cut(s)	45
SspI	AATATT	2 cut(s)	283, 658
SspMI	CTAG	3 cut(s)	581, 617, 919
StyD4I	CCNGG	1 cut(s)	823
StyI	CCWWGG	2 cut(s)	89, 219
TaaI	ACNGT	3 cut(s)	16, 80, 529
TaiI	ACGT	5 cut(s)	211, 361, 391, 646, 732
TaqI	TCGA	1 cut(s)	777
TasI	AATT	4 cut(s)	254, 271, 734, 784
TfiI	GAWTC	1 cut(s)	428
Tru1I	TTAA	5 cut(s)	111, 258, 285, 408, 681
Tru9I	TTAA	5 cut(s)	111, 258, 285, 408, 681
TscAI	CASTG	2 cut(s)	468, 841
TspDTI	ATGAA	4 cut(s)	17, 141, 261, 579
TspGWI	ACGGA	2 cut(s)	559, 747
TspRI	CASTG	2 cut(s)	468, 841
XapI	RAATTY	1 cut(s)	254
XspI	CTAG	3 cut(s)	581, 617, 919

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.