Rh5DG507400

Ferrous iron transport protein B

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
79263084 .. 79263916
833 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG507400.1

Sequence Viewer

Length: 528 bp
ATGGAATCCATTACAACTGATGATGGTCGGAGTGCTTCACTGAAGAAACATAACCAAATAAAACCAGACTTGCAAAAATCCCCAAATATATCTCTTCCAAATACTGTGAAGAAAAAAGCACGGAACAAGAATATCTCGGATGAAGGATCAGAGGTGCTAGATGGTCAGCCAAAGAAGAAGAAGCAAATGCGACTAGATCCGTACGACATTTCAAATAAACGTCTTGATGATAGTATTGCTACAAATGTTTTCTTTTCATGCAGAAAACTTAAAGGAAAGGAAAACGATGTTGAGGAAAACGCTGAGATATCAAAGAACGCACAATTTCGTGCAATCCAACCAAGTCCGTCAATCCTCTCCTATGTCGAAGATAATTTGTTGGGTCGTAGACGCTTGATTGAGCTGAAGAGGGCAGGCTACAACACTGAGCTTTCTGCACCATTGGATAATACTCCTTTCTCTATCCTCCTTTCTCTATCAGCTCCGAAAGAGAGCGAATTGAGGAAAATGTATGTAATGCAAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

175

Amino Acids

19.81

Weight (kDa)

9.45

Isoelectric Point (pI)

63.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 388
AclWI GGATC 2 cut(s) 154, 191
AcuI CTGAAG 2 cut(s) 62, 425
AfaI GTAC 1 cut(s) 203
AgsI TTSAA 1 cut(s) 213
AluBI AGCT 3 cut(s) 403, 430, 482
AluI AGCT 3 cut(s) 403, 430, 482
AlwI GGATC 2 cut(s) 154, 191
BccI CCATC 2 cut(s) 17, 155
BfaI CTAG 3 cut(s) 158, 194, 526
BseGI GGATG 1 cut(s) 145
BseMII CTCAG 2 cut(s) 294, 417
BsgI GTGCAG 1 cut(s) 420
BsiWI CGTACG 1 cut(s) 201
Bsp143I GATC 2 cut(s) 146, 196
BspCNI CTCAG 2 cut(s) 295, 418
BspPI GGATC 2 cut(s) 154, 191
BssMI GATC 2 cut(s) 146, 196
Bst4CI ACNGT 1 cut(s) 106
Bst6I CTCTTC 2 cut(s) 99, 401
BstC8I GCNNGC 1 cut(s) 415
BstDEI CTNAG 2 cut(s) 303, 426
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 2 cut(s) 149, 199
BstMBI GATC 2 cut(s) 146, 196
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BtsCI GGATG 1 cut(s) 145
BtsIMutI CAGTG 2 cut(s) 38, 423
Cac8I GCNNGC 1 cut(s) 415
CseI GACGC 1 cut(s) 399
Csp6I GTAC 1 cut(s) 202
CviAII CATG 1 cut(s) 258
CviJI RGCY 5 cut(s) 169, 403, 417, 430, 482
CviKI_1 RGCY 5 cut(s) 169, 403, 417, 430, 482
CviQI GTAC 1 cut(s) 202
DdeI CTNAG 2 cut(s) 303, 426
DpnI GATC 2 cut(s) 148, 198
DpnII GATC 2 cut(s) 146, 196
Eam1104I CTCTTC 2 cut(s) 99, 401
EarI CTCTTC 2 cut(s) 99, 401
Eco32I GATATC 1 cut(s) 309
Eco57I CTGAAG 2 cut(s) 62, 425
EcoRV GATATC 1 cut(s) 309
FaeI CATG 1 cut(s) 261
FaiI YATR 5 cut(s) 51, 89, 259, 363, 513
FatI CATG 1 cut(s) 257
FblI GTMKAC 1 cut(s) 388
FokI GGATG 1 cut(s) 152
FspBI CTAG 3 cut(s) 158, 194, 526
HgaI GACGC 1 cut(s) 399
Hin1II CATG 1 cut(s) 261
HinfI GANTC 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 389
Hpy188I TCNGA 4 cut(s) 30, 139, 151, 486
Hpy188III TCNNGA 1 cut(s) 224
Hpy8I GTNNAC 1 cut(s) 389
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 5 cut(s) 73, 261, 332, 437, 520
HpyF3I CTNAG 2 cut(s) 303, 426
HpySE526I ACGT 1 cut(s) 220
Hsp92II CATG 1 cut(s) 261
Kzo9I GATC 2 cut(s) 146, 196
LmnI GCTCC 1 cut(s) 487
LpnPI CCDG 2 cut(s) 78, 399
MaeI CTAG 3 cut(s) 158, 194, 526
MaeII ACGT 1 cut(s) 220
MalI GATC 2 cut(s) 148, 198
MboI GATC 2 cut(s) 146, 196
MboII GAAGA 7 cut(s) 55, 86, 121, 187, 190, 380, 418
MflI RGATCY 1 cut(s) 196
MluCI AATT 3 cut(s) 323, 373, 497
MmeI TCCRAC 2 cut(s) 8, 361
MnlI CCTC 6 cut(s) 145, 286, 365, 402, 476, 495
MseI TTAA 1 cut(s) 270
NdeII GATC 2 cut(s) 146, 196
NlaIII CATG 1 cut(s) 261
PfeI GAWTC 1 cut(s) 5
Pfl23II CGTACG 1 cut(s) 201
PspLI CGTACG 1 cut(s) 201
PsuI RGATCY 1 cut(s) 196
RsaI GTAC 1 cut(s) 203
RsaNI GTAC 1 cut(s) 202
SaqAI TTAA 1 cut(s) 270
Sau3AI GATC 2 cut(s) 146, 196
SetI ASST 5 cut(s) 156, 223, 405, 432, 484
Sse9I AATT 3 cut(s) 323, 373, 497
SspMI CTAG 3 cut(s) 158, 194, 526
TaaI ACNGT 1 cut(s) 106
TaiI ACGT 1 cut(s) 223
TaqI TCGA 1 cut(s) 366
TasI AATT 3 cut(s) 323, 373, 497
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
TscAI CASTG 2 cut(s) 45, 430
TspDTI ATGAA 2 cut(s) 156, 246
TspGWI ACGGA 3 cut(s) 136, 189, 336
TspRI CASTG 2 cut(s) 45, 430
XmiI GTMKAC 1 cut(s) 388
XspI CTAG 3 cut(s) 158, 194, 526
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.