Rw5G044130

Ferrous iron transport protein B

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
77519720 .. 77521215
1496 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G044130.1

Sequence Viewer

Length: 498 bp
ATGGAATCCATTACAACTGATGATGGTCGGAGTGCTTCACTGAAGAAACATAACCAAATAAAACCAGACTTGCAAAAATCCCCAAATATATCTCTTCCAAATACTGTGAAGAAAAAAGCACGGAACAAGAATATCTCGGATGAAGGATCAGAGGTGCTAGATGGTCAGCCAAAGAAGAAGAAGCAAATGCGACTAGATCCATACGACATTTCAAATAAACGTCTTGATGATAGTATTGCTACAAATGGTCAAAAACTTAAAGGAAAGGAAAACGCTGAGATATCAAAGAACGCACAATTTCGTGCAATCCAACCAAGTCTGTCAGTCCTCTCCTATGTCGAAGATAATTTGTTGGGTCGTAGACGCTTGATTGAACTGAAGAGGGCAGGCTACAACACTGAGCTTTCTGCACCATTGGATAATACTCCATTCTCTATCAGCTCCGAAACAGTTTTGAGGAAAATGAAGGTCAAATGTTGGGAAATCGTCACTACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

165

Amino Acids

18.58

Weight (kDa)

9.71

Isoelectric Point (pI)

54.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 361
AclWI GGATC 2 cut(s) 154, 191
AcuI CTGAAG 2 cut(s) 62, 398
AgsI TTSAA 2 cut(s) 213, 374
AluBI AGCT 2 cut(s) 403, 441
AluI AGCT 2 cut(s) 403, 441
AlwI GGATC 2 cut(s) 154, 191
BccI CCATC 2 cut(s) 17, 155
BfaI CTAG 2 cut(s) 158, 194
BseGI GGATG 1 cut(s) 145
BseMII CTCAG 2 cut(s) 267, 390
BsgI GTGCAG 1 cut(s) 393
Bsp143I GATC 2 cut(s) 146, 196
BspCNI CTCAG 2 cut(s) 268, 391
BspPI GGATC 2 cut(s) 154, 191
BssMI GATC 2 cut(s) 146, 196
Bst4CI ACNGT 2 cut(s) 106, 451
Bst6I CTCTTC 2 cut(s) 99, 374
BstC8I GCNNGC 1 cut(s) 388
BstDEI CTNAG 2 cut(s) 276, 399
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 2 cut(s) 149, 199
BstMBI GATC 2 cut(s) 146, 196
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BtsCI GGATG 1 cut(s) 145
BtsIMutI CAGTG 2 cut(s) 38, 396
Cac8I GCNNGC 1 cut(s) 388
CseI GACGC 1 cut(s) 372
CviJI RGCY 4 cut(s) 169, 390, 403, 441
CviKI_1 RGCY 4 cut(s) 169, 390, 403, 441
DdeI CTNAG 2 cut(s) 276, 399
DpnI GATC 2 cut(s) 148, 198
DpnII GATC 2 cut(s) 146, 196
Eam1104I CTCTTC 2 cut(s) 99, 374
EarI CTCTTC 2 cut(s) 99, 374
Eco32I GATATC 1 cut(s) 282
Eco57I CTGAAG 2 cut(s) 62, 398
EcoRV GATATC 1 cut(s) 282
FaiI YATR 4 cut(s) 51, 89, 202, 336
FblI GTMKAC 1 cut(s) 361
FokI GGATG 1 cut(s) 152
FspBI CTAG 2 cut(s) 158, 194
HgaI GACGC 1 cut(s) 372
HinfI GANTC 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 362
Hpy188I TCNGA 4 cut(s) 30, 139, 151, 445
Hpy188III TCNNGA 1 cut(s) 224
Hpy8I GTNNAC 1 cut(s) 362
HpyAV CCTTC 2 cut(s) 137, 460
HpyCH4III ACNGT 2 cut(s) 106, 451
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 3 cut(s) 73, 305, 410
HpyF3I CTNAG 2 cut(s) 276, 399
HpySE526I ACGT 1 cut(s) 220
Kzo9I GATC 2 cut(s) 146, 196
LmnI GCTCC 1 cut(s) 446
LpnPI CCDG 2 cut(s) 78, 372
MaeI CTAG 2 cut(s) 158, 194
MaeII ACGT 1 cut(s) 220
MaeIII GTNAC 1 cut(s) 487
MalI GATC 2 cut(s) 148, 198
MboI GATC 2 cut(s) 146, 196
MboII GAAGA 7 cut(s) 55, 86, 121, 187, 190, 353, 391
MflI RGATCY 1 cut(s) 196
MluCI AATT 2 cut(s) 296, 346
MmeI TCCRAC 2 cut(s) 8, 334
MnlI CCTC 4 cut(s) 145, 338, 375, 450
MseI TTAA 2 cut(s) 258, 496
NdeII GATC 2 cut(s) 146, 196
NmuCI GTSAC 1 cut(s) 487
PfeI GAWTC 1 cut(s) 5
PsuI RGATCY 1 cut(s) 196
SaqAI TTAA 2 cut(s) 258, 496
Sau3AI GATC 2 cut(s) 146, 196
SetI ASST 5 cut(s) 156, 223, 405, 443, 471
Sse9I AATT 2 cut(s) 296, 346
SspMI CTAG 2 cut(s) 158, 194
TaaI ACNGT 2 cut(s) 106, 451
TaiI ACGT 1 cut(s) 223
TaqI TCGA 1 cut(s) 339
TasI AATT 2 cut(s) 296, 346
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 2 cut(s) 258, 496
Tru9I TTAA 2 cut(s) 258, 496
TscAI CASTG 2 cut(s) 45, 403
TseFI GTSAC 1 cut(s) 487
Tsp45I GTSAC 1 cut(s) 487
TspDTI ATGAA 2 cut(s) 156, 479
TspGWI ACGGA 1 cut(s) 136
TspRI CASTG 2 cut(s) 45, 403
XmiI GTMKAC 1 cut(s) 361
XspI CTAG 2 cut(s) 158, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.