RchiOBHm_Chr6g0271841

Heme-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0005531
Physical Location & Seq
Forward (+)
31881712 .. 31882123
412 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24384

Sequence Viewer

Length: 327 bp
ATGACAGCTCCTGTGTTGACAAGCATTGTCCCTGGAGCTGGCCCTCTGCACTCATCCGCATGCTTTGTGAGATTCTATTTGCCAATGAATCATTACATTGCGGTCAGGAAATTCTCGGGATTTGCAAGAGATAGTAACATTGTGCAAGAAGCACATAAACTAGCCACAAGACTTAGCAGGTCTCCATGGGCTAATTCTACATCAGAAGAAAGTAGATCTGCTTACTCGATTGCACAGTATAATTCTCCTTTCCGGTTGATTGGGTGTGTGAATGAAGTTTGGGTCGATGTCAATGCCTCTGGATTGCTTTTCAATTTTTTTTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SOUL

Protein Analysis

108

Amino Acids

12.05

Weight (kDa)

9.14

Isoelectric Point (pI)

59.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SOUL PF04832 31 - 95 9e-14 SOUL heme-binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 168
AciI CCGC 2 cut(s) 57, 101
AcsI RAATTY 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 313
AjnI CCWGG 1 cut(s) 31
AluBI AGCT 2 cut(s) 8, 38
AluI AGCT 2 cut(s) 8, 38
Alw26I GTCTC 1 cut(s) 186
AlwNI CAGNNNCTG 1 cut(s) 11
Ama87I CYCGRG 1 cut(s) 115
AoxI GGCC 1 cut(s) 40
ApoI RAATTY 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 41
AvaI CYCGRG 1 cut(s) 115
BcgI CGANNNNNNTGC 2 cut(s) 275, 309
BciT130I CCWGG 1 cut(s) 33
BcoDI GTCTC 1 cut(s) 186
BfaI CTAG 1 cut(s) 161
BfuAI ACCTGC 1 cut(s) 168
BglII AGATCT 1 cut(s) 215
Bme1390I CCNGG 1 cut(s) 33
BmeT110I CYCGRG 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 33
BpmI CTGGAG 1 cut(s) 54
BsaI GGTCTC 1 cut(s) 186
BsaJI CCNNGG 2 cut(s) 31, 185
BsaWI WCCGGW 1 cut(s) 252
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse3DI GCAATG 1 cut(s) 96
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 2 cut(s) 31, 185
BseGI GGATG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 38
BseMI GCAATG 1 cut(s) 96
BsgI GTGCAG 1 cut(s) 32
BshFI GGCC 1 cut(s) 42
BsiHKCI CYCGRG 1 cut(s) 115
BsiSI CCGG 1 cut(s) 253
BslFI GGGAC 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 186
BsmFI GGGAC 1 cut(s) 14
BsnI GGCC 1 cut(s) 42
Bso31I GGTCTC 1 cut(s) 186
BsoBI CYCGRG 1 cut(s) 115
Bsp143I GATC 1 cut(s) 215
Bsp19I CCATGG 1 cut(s) 185
BspACI CCGC 2 cut(s) 57, 101
BspANI GGCC 1 cut(s) 42
BspMI ACCTGC 1 cut(s) 168
BspTNI GGTCTC 1 cut(s) 186
BsrDI GCAATG 1 cut(s) 96
BssECI CCNNGG 2 cut(s) 31, 185
BssMI GATC 1 cut(s) 215
BssT1I CCWWGG 1 cut(s) 185
Bst2UI CCWGG 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 237
BstC8I GCNNGC 2 cut(s) 40, 61
BstDEI CTNAG 1 cut(s) 173
BstDSI CCRYGG 1 cut(s) 185
BstF5I GGATG 1 cut(s) 53
BstKTI GATC 1 cut(s) 218
BstMAI GTCTC 1 cut(s) 186
BstMBI GATC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 33
BstNSI RCATGY 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 215
BstYI RGATCY 1 cut(s) 215
BsuRI GGCC 1 cut(s) 42
BtgI CCRYGG 1 cut(s) 185
BtsCI GGATG 1 cut(s) 53
BveI ACCTGC 1 cut(s) 168
Cac8I GCNNGC 2 cut(s) 40, 61
CaiI CAGNNNCTG 1 cut(s) 11
Cfr13I GGNCC 1 cut(s) 41
CviAII CATG 2 cut(s) 60, 186
CviJI RGCY 5 cut(s) 8, 38, 42, 164, 191
CviKI_1 RGCY 5 cut(s) 8, 38, 42, 164, 191
DdeI CTNAG 1 cut(s) 173
DpnI GATC 1 cut(s) 217
DpnII GATC 1 cut(s) 215
Eco130I CCWWGG 1 cut(s) 185
Eco31I GGTCTC 1 cut(s) 186
Eco88I CYCGRG 1 cut(s) 115
EcoRII CCWGG 1 cut(s) 31
EcoT14I CCWWGG 1 cut(s) 185
ErhI CCWWGG 1 cut(s) 185
FaeI CATG 2 cut(s) 63, 189
FaiI YATR 4 cut(s) 61, 156, 187, 240
FaqI GGGAC 1 cut(s) 14
FatI CATG 2 cut(s) 59, 185
FokI GGATG 1 cut(s) 40
FspBI CTAG 1 cut(s) 161
GsuI CTGGAG 1 cut(s) 54
HaeIII GGCC 1 cut(s) 42
HapII CCGG 1 cut(s) 253
Hin1II CATG 2 cut(s) 63, 189
HincII GTYRAC 1 cut(s) 18
HindII GTYRAC 1 cut(s) 18
HinfI GANTC 2 cut(s) 72, 88
HpaII CCGG 1 cut(s) 253
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 3 cut(s) 106, 117, 300
Hpy8I GTNNAC 1 cut(s) 18
HpyCH4III ACNGT 1 cut(s) 237
HpyCH4V TGCA 4 cut(s) 49, 125, 145, 233
HpyF3I CTNAG 1 cut(s) 173
Hsp92II CATG 2 cut(s) 63, 189
Kzo9I GATC 1 cut(s) 215
LmnI GCTCC 2 cut(s) 13, 35
LpnPI CCDG 8 cut(s) 18, 24, 24, 45, 91, 163, 266, 285
MaeI CTAG 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 134
MalI GATC 1 cut(s) 217
MboI GATC 1 cut(s) 215
MboII GAAGA 1 cut(s) 218
MflI RGATCY 1 cut(s) 215
MluCI AATT 4 cut(s) 110, 193, 241, 313
MnlI CCTC 2 cut(s) 54, 307
MslI CAYNNNNRTG 1 cut(s) 58
MspI CCGG 1 cut(s) 253
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
NcoI CCATGG 1 cut(s) 185
NdeII GATC 1 cut(s) 215
NlaIII CATG 2 cut(s) 63, 189
NspI RCATGY 1 cut(s) 63
PaeI GCATGC 1 cut(s) 63
PfeI GAWTC 2 cut(s) 72, 88
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
PspPI GGNCC 1 cut(s) 41
PstNI CAGNNNCTG 1 cut(s) 11
PsuI RGATCY 1 cut(s) 215
RseI CAYNNNNRTG 1 cut(s) 58
Sau3AI GATC 1 cut(s) 215
Sau96I GGNCC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 33
SetI ASST 3 cut(s) 10, 40, 182
SmiMI CAYNNNNRTG 1 cut(s) 58
SphI GCATGC 1 cut(s) 63
Sse9I AATT 4 cut(s) 110, 193, 241, 313
SsiI CCGC 2 cut(s) 57, 101
SspMI CTAG 1 cut(s) 161
StyD4I CCNGG 1 cut(s) 31
StyI CCWWGG 1 cut(s) 185
TaaI ACNGT 1 cut(s) 237
TaqI TCGA 2 cut(s) 227, 285
TasI AATT 4 cut(s) 110, 193, 241, 313
TfiI GAWTC 2 cut(s) 72, 88
TspDTI ATGAA 2 cut(s) 101, 288
XapI RAATTY 1 cut(s) 110
XceI RCATGY 1 cut(s) 63
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.