Rh6BG216900

Heme-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0005531
Physical Location & Seq
Reverse (-)
40888105 .. 40889954
1850 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG216900.1

Sequence Viewer

Length: 345 bp
ATGACAGCCCCTGTGCTGACAAGAATTGTCCCTAGAGCTGGCCCTCTGCACTCATCCGCATACTTTGTGAGATTCTATTTGCCAGTGAAGTTTCAAGCTTCCCCACCCACACCCCTCTCGGAACTCAACTTGAAACCTTATACATGGGATAGTCATTACATTGCGGTCAGAAAATTCTTGGGATTGGCAAGAGATAGTAACATTGTGCAAGAAGCACATAAACTCGCCACCAGCCTTAGCAAGTCTCCATGGGCTAACTCTACATCAAAAGAAAGTAGATCTGCTTACTTAATTGCACAGTATAACTCCCCTTTCAGGTTGATTGGGCGTGTGAATGAAGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SOUL

Protein Analysis

114

Amino Acids

12.83

Weight (kDa)

10.13

Isoelectric Point (pI)

51.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SOUL PF04832 1 - 114 7.3e-27 SOUL heme-binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 57, 164
AcsI RAATTY 1 cut(s) 173
AfiI CCNNNNNNNGG 2 cut(s) 38, 315
AgsI TTSAA 2 cut(s) 95, 133
AluBI AGCT 2 cut(s) 38, 98
AluI AGCT 2 cut(s) 38, 98
Alw26I GTCTC 1 cut(s) 249
AlwNI CAGNNNCTG 1 cut(s) 11
AoxI GGCC 1 cut(s) 40
ApoI RAATTY 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 249
BfaI CTAG 1 cut(s) 33
BglII AGATCT 1 cut(s) 278
BmgT120I GGNCC 1 cut(s) 41
Bpu10I CCTNAGC 1 cut(s) 236
BsaJI CCNNGG 1 cut(s) 248
Bsc4I CCNNNNNNNGG 2 cut(s) 38, 315
Bse1I ACTGG 1 cut(s) 83
Bse3DI GCAATG 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 248
BseGI GGATG 1 cut(s) 53
BseLI CCNNNNNNNGG 2 cut(s) 38, 315
BseMI GCAATG 1 cut(s) 159
BseNI ACTGG 1 cut(s) 83
BsgI GTGCAG 1 cut(s) 32
BshFI GGCC 1 cut(s) 42
BslFI GGGAC 1 cut(s) 14
BslI CCNNNNNNNGG 2 cut(s) 38, 315
BsmAI GTCTC 1 cut(s) 249
BsmFI GGGAC 1 cut(s) 14
BsnI GGCC 1 cut(s) 42
Bsp143I GATC 1 cut(s) 278
Bsp19I CCATGG 1 cut(s) 248
BspACI CCGC 2 cut(s) 57, 164
BspANI GGCC 1 cut(s) 42
BsrDI GCAATG 1 cut(s) 159
BsrI ACTGG 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 248
BssMI GATC 1 cut(s) 278
BssT1I CCWWGG 1 cut(s) 248
Bst4CI ACNGT 1 cut(s) 300
BstC8I GCNNGC 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 236
BstDSI CCRYGG 1 cut(s) 248
BstF5I GGATG 1 cut(s) 53
BstKTI GATC 1 cut(s) 281
BstMAI GTCTC 1 cut(s) 249
BstMBI GATC 1 cut(s) 278
BstX2I RGATCY 1 cut(s) 278
BstYI RGATCY 1 cut(s) 278
BsuRI GGCC 1 cut(s) 42
BtgI CCRYGG 1 cut(s) 248
BtsCI GGATG 1 cut(s) 53
BtsIMutI CAGTG 1 cut(s) 90
Cac8I GCNNGC 1 cut(s) 40
CaiI CAGNNNCTG 1 cut(s) 11
Cfr13I GGNCC 1 cut(s) 41
CviAII CATG 2 cut(s) 144, 249
CviJI RGCY 6 cut(s) 8, 38, 42, 98, 234, 254
CviKI_1 RGCY 6 cut(s) 8, 38, 42, 98, 234, 254
DdeI CTNAG 1 cut(s) 236
DpnI GATC 1 cut(s) 280
DpnII GATC 1 cut(s) 278
Eco130I CCWWGG 1 cut(s) 248
EcoT14I CCWWGG 1 cut(s) 248
ErhI CCWWGG 1 cut(s) 248
FaeI CATG 2 cut(s) 147, 252
FaiI YATR 6 cut(s) 61, 141, 145, 219, 250, 303
FaqI GGGAC 1 cut(s) 14
FatI CATG 2 cut(s) 143, 248
FokI GGATG 1 cut(s) 40
FspBI CTAG 1 cut(s) 33
HaeIII GGCC 1 cut(s) 42
Hin1II CATG 2 cut(s) 147, 252
HindIII AAGCTT 1 cut(s) 96
HinfI GANTC 1 cut(s) 72
Hpy188I TCNGA 2 cut(s) 121, 170
HpyCH4III ACNGT 1 cut(s) 300
HpyCH4V TGCA 3 cut(s) 49, 208, 296
HpyF3I CTNAG 1 cut(s) 236
Hsp92II CATG 2 cut(s) 147, 252
Kzo9I GATC 1 cut(s) 278
LpnPI CCDG 5 cut(s) 24, 24, 96, 244, 301
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 1 cut(s) 197
MalI GATC 1 cut(s) 280
MboI GATC 1 cut(s) 278
MflI RGATCY 1 cut(s) 278
MluCI AATT 3 cut(s) 24, 173, 291
MnlI CCTC 2 cut(s) 54, 125
MseI TTAA 1 cut(s) 290
NcoI CCATGG 1 cut(s) 248
NdeII GATC 1 cut(s) 278
NlaIII CATG 2 cut(s) 147, 252
PfeI GAWTC 1 cut(s) 72
PspPI GGNCC 1 cut(s) 41
PstNI CAGNNNCTG 1 cut(s) 11
PsuI RGATCY 1 cut(s) 278
SaqAI TTAA 1 cut(s) 290
Sau3AI GATC 1 cut(s) 278
Sau96I GGNCC 1 cut(s) 41
SetI ASST 4 cut(s) 40, 100, 139, 320
Sse9I AATT 3 cut(s) 24, 173, 291
SsiI CCGC 2 cut(s) 57, 164
SspMI CTAG 1 cut(s) 33
StyI CCWWGG 1 cut(s) 248
TaaI ACNGT 1 cut(s) 300
TasI AATT 3 cut(s) 24, 173, 291
TfiI GAWTC 1 cut(s) 72
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TscAI CASTG 1 cut(s) 90
TspRI CASTG 1 cut(s) 90
XapI RAATTY 1 cut(s) 173
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.