RchiOBHm_Chr6g0271881

snRNA-activating protein complex

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
31898522 .. 31901118
2597 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24388

Sequence Viewer

Length: 264 bp
ATGTTTACCATAATGTGCAAAACTAGATCAAGGGTTACCCAAGGATTCTTGGTCGTTGGACGAAAAACCTTGACTGAGTTGAGGGATAAGATATACTGTTTAACAGATAAGGTGATGGAAAAAGATGGCCAGCATAATCATTCAGGATGTTTCCTTATAGAAGATAGATTCTACAAAGATCTGAGGGTTCCTTCTGCATTATATTATAGTCGATCTGTATATGATTGGCTTAGAAATTTAAGAGATGATGCTCTAAAAAACTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

10.37

Weight (kDa)

9.3

Isoelectric Point (pI)

53.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SNAPC3 PF12251 15 - 80 1.5e-16 snRNA-activating protein complex (SNAPc), subunit 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 127
AcsI RAATTY 1 cut(s) 235
AoxI GGCC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 235
AsuHPI GGTGA 1 cut(s) 124
BalI TGGCCA 1 cut(s) 129
BccI CCATC 2 cut(s) 109, 119
BfaI CTAG 1 cut(s) 24
BglII AGATCT 1 cut(s) 178
BmiI GGNNCC 1 cut(s) 189
BmsI GCATC 1 cut(s) 238
BsaJI CCNNGG 1 cut(s) 40
BseDI CCNNGG 1 cut(s) 40
BseGI GGATG 1 cut(s) 152
BseMII CTCAG 2 cut(s) 66, 173
BshFI GGCC 1 cut(s) 129
BsnI GGCC 1 cut(s) 129
Bsp143I GATC 3 cut(s) 26, 178, 212
BspANI GGCC 1 cut(s) 129
BspCNI CTCAG 2 cut(s) 67, 174
BspLI GGNNCC 1 cut(s) 189
BssECI CCNNGG 1 cut(s) 40
BssMI GATC 3 cut(s) 26, 178, 212
BssT1I CCWWGG 1 cut(s) 40
Bst4CI ACNGT 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 3 cut(s) 75, 182, 230
BstEII GGTNACC 1 cut(s) 34
BstF5I GGATG 1 cut(s) 152
BstKTI GATC 3 cut(s) 29, 181, 215
BstMBI GATC 3 cut(s) 26, 178, 212
BstPI GGTNACC 1 cut(s) 34
BstX2I RGATCY 1 cut(s) 178
BstYI RGATCY 1 cut(s) 178
BsuRI GGCC 1 cut(s) 129
BtsCI GGATG 1 cut(s) 152
Cac8I GCNNGC 1 cut(s) 131
CviJI RGCY 2 cut(s) 129, 229
CviKI_1 RGCY 2 cut(s) 129, 229
DdeI CTNAG 3 cut(s) 75, 182, 230
DpnI GATC 3 cut(s) 28, 180, 214
DpnII GATC 3 cut(s) 26, 178, 212
EaeI YGGCCR 1 cut(s) 127
Eco130I CCWWGG 1 cut(s) 40
Eco91I GGTNACC 1 cut(s) 34
EcoO65I GGTNACC 1 cut(s) 34
EcoT14I CCWWGG 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 40
FaiI YATR 8 cut(s) 11, 94, 135, 158, 202, 207, 220, 222
FokI GGATG 1 cut(s) 159
FspBI CTAG 1 cut(s) 24
HaeIII GGCC 1 cut(s) 129
HinfI GANTC 2 cut(s) 45, 168
HphI GGTGA 1 cut(s) 124
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 183
Hpy188III TCNNGA 1 cut(s) 144
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 201
HpyCH4III ACNGT 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 18, 197
HpyF3I CTNAG 3 cut(s) 75, 182, 230
Kzo9I GATC 3 cut(s) 26, 178, 212
LpnPI CCDG 2 cut(s) 129, 143
LweI GCATC 1 cut(s) 238
MaeI CTAG 1 cut(s) 24
MaeIII GTNAC 1 cut(s) 34
MalI GATC 3 cut(s) 28, 180, 214
MboI GATC 3 cut(s) 26, 178, 212
MboII GAAGA 1 cut(s) 173
MflI RGATCY 1 cut(s) 178
MlsI TGGCCA 1 cut(s) 129
MluCI AATT 1 cut(s) 235
MluNI TGGCCA 1 cut(s) 129
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 2 cut(s) 75, 177
Mox20I TGGCCA 1 cut(s) 129
MscI TGGCCA 1 cut(s) 129
MseI TTAA 2 cut(s) 101, 239
Msp20I TGGCCA 1 cut(s) 129
NdeII GATC 3 cut(s) 26, 178, 212
NlaIV GGNNCC 1 cut(s) 189
PfeI GAWTC 2 cut(s) 45, 168
PspEI GGTNACC 1 cut(s) 34
PspN4I GGNNCC 1 cut(s) 189
PsuI RGATCY 1 cut(s) 178
SaqAI TTAA 2 cut(s) 101, 239
Sau3AI GATC 3 cut(s) 26, 178, 212
SetI ASST 2 cut(s) 71, 114
SfaNI GCATC 1 cut(s) 238
SgeI CNNG 7 cut(s) 36, 42, 53, 61, 82, 142, 156
Sse9I AATT 1 cut(s) 235
SspMI CTAG 1 cut(s) 24
StyI CCWWGG 1 cut(s) 40
TaaI ACNGT 1 cut(s) 98
TaqI TCGA 1 cut(s) 211
TasI AATT 1 cut(s) 235
TfiI GAWTC 2 cut(s) 45, 168
Tru1I TTAA 2 cut(s) 101, 239
Tru9I TTAA 2 cut(s) 101, 239
XapI RAATTY 1 cut(s) 235
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.