RchiOBHm_Chr7g0217251

snRNA-activating protein complex

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
35125217 .. 35126587
1371 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19441

Sequence Viewer

Length: 144 bp
ATGCTGGAAAATTGCAAAAGAAGGAAAAAAGCAGTTGTATGCAACATAACTGGCTCAAAATTGCATCTGTTCGAAGCTGATGATATGCACAAGACACAGTTTTGCAACTTGAAATTTCAACCTGCTGATATGTCACCAGGGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.38

Weight (kDa)

8.99

Isoelectric Point (pI)

69.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 130
AcsI RAATTY 1 cut(s) 113
AgsI TTSAA 2 cut(s) 112, 119
AjnI CCWGG 1 cut(s) 136
AleI CACNNNNGTG 1 cut(s) 139
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
ApoI RAATTY 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 126
AsuII TTCGAA 1 cut(s) 72
BciT130I CCWGG 1 cut(s) 138
BfuAI ACCTGC 1 cut(s) 130
Bme1390I CCNGG 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 138
BmsI GCATC 1 cut(s) 73
Bpu14I TTCGAA 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 137
Bse1I ACTGG 1 cut(s) 55
BseBI CCWGG 1 cut(s) 138
BseDI CCNNGG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 55
Bsp119I TTCGAA 1 cut(s) 72
BspMI ACCTGC 1 cut(s) 130
BspT104I TTCGAA 1 cut(s) 72
BsrI ACTGG 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 137
Bst2UI CCWGG 1 cut(s) 138
Bst4CI ACNGT 1 cut(s) 99
BstBI TTCGAA 1 cut(s) 72
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BveI ACCTGC 1 cut(s) 130
CviJI RGCY 2 cut(s) 54, 77
CviKI_1 RGCY 2 cut(s) 54, 77
EcoRII CCWGG 1 cut(s) 136
FaiI YATR 4 cut(s) 40, 47, 86, 131
FspEI CC 5 cut(s) 7, 36, 123, 124, 135
HphI GGTGA 1 cut(s) 126
HpyAV CCTTC 1 cut(s) 15
HpyCH4III ACNGT 1 cut(s) 99
HpyCH4V TGCA 5 cut(s) 15, 42, 64, 88, 105
LpnPI CCDG 3 cut(s) 36, 123, 135
LweI GCATC 1 cut(s) 73
MaeIII GTNAC 1 cut(s) 132
MluCI AATT 3 cut(s) 10, 59, 113
MslI CAYNNNNRTG 1 cut(s) 139
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
NmuCI GTSAC 1 cut(s) 132
NspV TTCGAA 1 cut(s) 72
OliI CACNNNNGTG 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 139
ScrFI CCNGG 1 cut(s) 138
SetI ASST 2 cut(s) 79, 124
SfaNI GCATC 1 cut(s) 73
SfuI TTCGAA 1 cut(s) 72
SgeI CNNG 5 cut(s) 17, 63, 103, 121, 134
SmiMI CAYNNNNRTG 1 cut(s) 139
Sse9I AATT 3 cut(s) 10, 59, 113
StyD4I CCNGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 99
TaqI TCGA 1 cut(s) 72
TasI AATT 3 cut(s) 10, 59, 113
TseFI GTSAC 1 cut(s) 132
Tsp45I GTSAC 1 cut(s) 132
XapI RAATTY 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.