Rh7AG306600

snRNA-activating protein complex

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
34276501 .. 34281620
5120 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG306600.1

Sequence Viewer

Length: 429 bp
ATGATTACAGTAGCAGATGATAAAGCTATTCCTCTTACTGGCCCAAAAATATCATGGGCAAATGGGAAAATGAACTCTTGTAATGGCAGCAGCTTAAATCAGAATCACAGCATTCAGGATTGCATACCTGTACACCATACAGAAGTTGCCCTTTCCATTGATGTTTACCATAATGTGCAAAACTGGATCAAGACCCAAGGATTCTTGGTCGTTGGACGATGTTTCCTCATAGAAGATAGATTCTACAAAGATCTGAGGGTTCCTTCTGCATTATATTATAGTCAATCTCTGGAAAATTGCAAAAGAAGGAAAAAAGCAGTTGTATGCAACATAACTGGCTCAAAATTGCCTCTGTTCCAAGCTGATGATATGCACAAGACACAGTTTTGCAACTTGAAATTTCAACTTACTGATATGTCACCAGGGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

142

Amino Acids

16.05

Weight (kDa)

8.76

Isoelectric Point (pI)

46.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SNAPC3 PF12251 67 - 137 6.8e-08 snRNA-activating protein complex (SNAPc), subunit 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 194
AcsI RAATTY 1 cut(s) 398
AfaI GTAC 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 2 cut(s) 397, 404
AjnI CCWGG 1 cut(s) 421
AleI CACNNNNGTG 1 cut(s) 424
AluBI AGCT 3 cut(s) 26, 93, 362
AluI AGCT 3 cut(s) 26, 93, 362
AlwI GGATC 1 cut(s) 194
AoxI GGCC 1 cut(s) 40
ApeKI GCWGC 2 cut(s) 87, 90
ApoI RAATTY 1 cut(s) 398
AspS9I GGNCC 1 cut(s) 41
AsuHPI GGTGA 1 cut(s) 411
BbvI GCAGC 2 cut(s) 99, 102
BciT130I CCWGG 1 cut(s) 423
BglII AGATCT 1 cut(s) 250
BisI GCNGC 2 cut(s) 88, 91
BlsI GCNGC 2 cut(s) 89, 92
Bme1390I CCNGG 1 cut(s) 423
BmgT120I GGNCC 1 cut(s) 41
BmiI GGNNCC 1 cut(s) 261
BmrFI CCNGG 1 cut(s) 423
BsaJI CCNNGG 2 cut(s) 196, 422
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse1I ACTGG 3 cut(s) 43, 188, 340
BseBI CCWGG 1 cut(s) 423
BseDI CCNNGG 2 cut(s) 196, 422
BseLI CCNNNNNNNGG 1 cut(s) 38
BseMII CTCAG 1 cut(s) 245
BseNI ACTGG 3 cut(s) 43, 188, 340
BseXI GCAGC 2 cut(s) 99, 102
BshFI GGCC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 38
BsmI GAATGC 1 cut(s) 111
BsnI GGCC 1 cut(s) 42
Bsp1407I TGTACA 1 cut(s) 130
Bsp143I GATC 2 cut(s) 186, 250
BspANI GGCC 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 246
BspLI GGNNCC 1 cut(s) 261
BspPI GGATC 1 cut(s) 194
BsrGI TGTACA 1 cut(s) 130
BsrI ACTGG 3 cut(s) 43, 188, 340
BssECI CCNNGG 2 cut(s) 196, 422
BssMI GATC 2 cut(s) 186, 250
BssT1I CCWWGG 1 cut(s) 196
Bst2UI CCWGG 1 cut(s) 423
Bst4CI ACNGT 2 cut(s) 10, 384
BstAUI TGTACA 1 cut(s) 130
BstDEI CTNAG 1 cut(s) 254
BstKTI GATC 2 cut(s) 189, 253
BstMBI GATC 2 cut(s) 186, 250
BstNI CCWGG 1 cut(s) 423
BstSCI CCNGG 1 cut(s) 421
BstV1I GCAGC 2 cut(s) 99, 102
BstX2I RGATCY 1 cut(s) 250
BstYI RGATCY 1 cut(s) 250
BsuRI GGCC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 41
Csp6I GTAC 1 cut(s) 131
CviAII CATG 1 cut(s) 54
CviJI RGCY 5 cut(s) 26, 42, 93, 339, 362
CviKI_1 RGCY 5 cut(s) 26, 42, 93, 339, 362
CviQI GTAC 1 cut(s) 131
DdeI CTNAG 1 cut(s) 254
DpnI GATC 2 cut(s) 188, 252
DpnII GATC 2 cut(s) 186, 250
Eco130I CCWWGG 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 421
EcoT14I CCWWGG 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 1 cut(s) 57
FalI AAGNNNNNCTT 2 cut(s) 135, 167
FatI CATG 1 cut(s) 53
Fnu4HI GCNGC 2 cut(s) 88, 91
Fsp4HI GCNGC 2 cut(s) 88, 91
GluI GCNGC 2 cut(s) 88, 91
HaeIII GGCC 1 cut(s) 42
Hin1II CATG 1 cut(s) 57
HinfI GANTC 3 cut(s) 103, 201, 240
HphI GGTGA 1 cut(s) 411
Hpy166II GTNNAC 2 cut(s) 133, 166
Hpy188I TCNGA 2 cut(s) 102, 255
Hpy188III TCNNGA 3 cut(s) 116, 190, 290
Hpy8I GTNNAC 2 cut(s) 133, 166
HpyAV CCTTC 2 cut(s) 273, 300
HpyCH4III ACNGT 2 cut(s) 10, 384
HpyCH4V TGCA 7 cut(s) 123, 178, 269, 300, 327, 373, 390
HpyF3I CTNAG 1 cut(s) 254
Hsp92II CATG 1 cut(s) 57
Kzo9I GATC 2 cut(s) 186, 250
LpnPI CCDG 7 cut(s) 24, 101, 141, 169, 275, 321, 408
Lsp1109I GCAGC 2 cut(s) 99, 102
MaeIII GTNAC 1 cut(s) 417
MalI GATC 2 cut(s) 188, 252
MboI GATC 2 cut(s) 186, 250
MboII GAAGA 1 cut(s) 245
MflI RGATCY 1 cut(s) 250
MluCI AATT 3 cut(s) 295, 344, 398
MmeI TCCRAC 1 cut(s) 193
MnlI CCTC 4 cut(s) 42, 236, 249, 360
MseI TTAA 1 cut(s) 95
MslI CAYNNNNRTG 1 cut(s) 424
MspR9I CCNGG 1 cut(s) 423
Mva1269I GAATGC 1 cut(s) 111
MvaI CCWGG 1 cut(s) 423
NdeII GATC 2 cut(s) 186, 250
NlaIII CATG 1 cut(s) 57
NlaIV GGNNCC 1 cut(s) 261
NmuCI GTSAC 1 cut(s) 417
OliI CACNNNNGTG 1 cut(s) 424
PctI GAATGC 1 cut(s) 111
PfeI GAWTC 3 cut(s) 103, 201, 240
PkrI GCNGC 2 cut(s) 89, 92
Psp6I CCWGG 1 cut(s) 421
PspGI CCWGG 1 cut(s) 421
PspN4I GGNNCC 1 cut(s) 261
PspPI GGNCC 1 cut(s) 41
PsuI RGATCY 1 cut(s) 250
RsaI GTAC 1 cut(s) 132
RsaNI GTAC 1 cut(s) 131
RseI CAYNNNNRTG 1 cut(s) 424
SaqAI TTAA 1 cut(s) 95
SatI GCNGC 2 cut(s) 88, 91
Sau3AI GATC 2 cut(s) 186, 250
Sau96I GGNCC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 423
SetI ASST 4 cut(s) 28, 95, 130, 364
SmiMI CAYNNNNRTG 1 cut(s) 424
Sse9I AATT 3 cut(s) 295, 344, 398
StyD4I CCNGG 1 cut(s) 421
StyI CCWWGG 1 cut(s) 196
TaaI ACNGT 2 cut(s) 10, 384
TasI AATT 3 cut(s) 295, 344, 398
TatI WGTACW 1 cut(s) 130
TfiI GAWTC 3 cut(s) 103, 201, 240
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TseFI GTSAC 1 cut(s) 417
TseI GCWGC 2 cut(s) 87, 90
Tsp45I GTSAC 1 cut(s) 417
TspDTI ATGAA 1 cut(s) 86
XapI RAATTY 1 cut(s) 398
XcmI CCANNNNNNNNNTGG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.