Rh7BG286500

snRNA-activating protein complex

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
26903920 .. 26909603
5684 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG286500.1

Sequence Viewer

Length: 336 bp
ATGCTTCCATTCATAACCTTGAATGGGAACTTTGCTGCAGATTGCCAAATCATGGAATCTGTAATGATGGAAAGTCTTGACAATGATGACGCTAGTTTTGCTTGGAGACCAAGAATTCTTGGTCCTAGGACGACAAGATCAAGCAATGAGTTGAGGGATAAGATATTCTGTTTAACAGACAAGGTGATGGAAAAAGATGGTCAGCATAATCATTCAGGATATTTCCTCATAGAAGATACATTCTACAACGATCTGAGGGATCCTTCTGCTTTTTCTTATAGTGGATCTATATTTGATTGGCTTAGAAATTCAAGAGATGATGCTCTTAAAAACTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.84

Weight (kDa)

4.72

Isoelectric Point (pI)

39.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SNAPC3 PF12251 49 - 104 3.4e-14 snRNA-activating protein complex (SNAPc), subunit 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 52
AclWI GGATC 3 cut(s) 254, 267, 292
AcsI RAATTY 2 cut(s) 114, 307
AfiI CCNNNNNNNGG 2 cut(s) 24, 52
AgsI TTSAA 2 cut(s) 22, 312
Alw26I GTCTC 1 cut(s) 100
AlwI GGATC 3 cut(s) 254, 267, 292
ApeKI GCWGC 1 cut(s) 35
ApoI RAATTY 2 cut(s) 114, 307
ArsI GACNNNNNNTTYG 2 cut(s) 80, 112
AspA2I CCTAGG 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 122
AsuHPI GGTGA 1 cut(s) 196
AvaII GGWCC 1 cut(s) 122
AvrII CCTAGG 1 cut(s) 125
BamHI GGATCC 1 cut(s) 259
BbvI GCAGC 1 cut(s) 22
BccI CCATC 3 cut(s) 61, 181, 191
BcoDI GTCTC 1 cut(s) 100
BfaI CTAG 2 cut(s) 93, 126
BfmI CTRYAG 1 cut(s) 36
BisI GCNGC 1 cut(s) 36
BlnI CCTAGG 1 cut(s) 125
BlsI GCNGC 1 cut(s) 37
Bme18I GGWCC 1 cut(s) 122
BmgT120I GGNCC 1 cut(s) 122
BmiI GGNNCC 1 cut(s) 261
BmsI GCATC 1 cut(s) 310
BsaI GGTCTC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 125
Bsc4I CCNNNNNNNGG 2 cut(s) 24, 52
Bse3DI GCAATG 1 cut(s) 151
BseDI CCNNGG 1 cut(s) 125
BseLI CCNNNNNNNGG 2 cut(s) 24, 52
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 245
BseXI GCAGC 1 cut(s) 22
BslI CCNNNNNNNGG 2 cut(s) 24, 52
BsmAI GTCTC 1 cut(s) 100
Bso31I GGTCTC 1 cut(s) 100
Bsp143I GATC 4 cut(s) 137, 250, 259, 284
BspCNI CTCAG 1 cut(s) 246
BspLI GGNNCC 1 cut(s) 261
BspMAI CTGCAG 1 cut(s) 40
BspPI GGATC 3 cut(s) 254, 267, 292
BspTNI GGTCTC 1 cut(s) 100
BsrDI GCAATG 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 125
BssMI GATC 4 cut(s) 137, 250, 259, 284
BssT1I CCWWGG 1 cut(s) 125
BstDEI CTNAG 2 cut(s) 254, 302
BstKTI GATC 4 cut(s) 140, 253, 262, 287
BstMAI GTCTC 1 cut(s) 100
BstMBI GATC 4 cut(s) 137, 250, 259, 284
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstSFI CTRYAG 1 cut(s) 36
BstV1I GCAGC 1 cut(s) 22
BstX2I RGATCY 2 cut(s) 259, 284
BstYI RGATCY 2 cut(s) 259, 284
Cfr13I GGNCC 1 cut(s) 122
CseI GACGC 1 cut(s) 98
CviAII CATG 1 cut(s) 52
CviJI RGCY 1 cut(s) 301
CviKI_1 RGCY 1 cut(s) 301
DdeI CTNAG 2 cut(s) 254, 302
DpnI GATC 4 cut(s) 139, 252, 261, 286
DpnII GATC 4 cut(s) 137, 250, 259, 284
Eco130I CCWWGG 1 cut(s) 125
Eco31I GGTCTC 1 cut(s) 100
Eco47I GGWCC 1 cut(s) 122
EcoRI GAATTC 1 cut(s) 114
EcoT14I CCWWGG 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 125
FaeI CATG 1 cut(s) 55
FaiI YATR 6 cut(s) 14, 53, 207, 230, 279, 290
FatI CATG 1 cut(s) 51
Fnu4HI GCNGC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 2 cut(s) 93, 126
GluI GCNGC 1 cut(s) 36
HgaI GACGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 55
HinfI GANTC 1 cut(s) 56
HphI GGTGA 1 cut(s) 196
Hpy188I TCNGA 1 cut(s) 255
Hpy188III TCNNGA 3 cut(s) 77, 216, 312
HpyAV CCTTC 1 cut(s) 273
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
HpyF3I CTNAG 2 cut(s) 254, 302
Hsp92II CATG 1 cut(s) 55
Kzo9I GATC 4 cut(s) 137, 250, 259, 284
LpnPI CCDG 1 cut(s) 201
Lsp1109I GCAGC 1 cut(s) 22
LweI GCATC 1 cut(s) 310
MaeI CTAG 2 cut(s) 93, 126
MalI GATC 4 cut(s) 139, 252, 261, 286
MboI GATC 4 cut(s) 137, 250, 259, 284
MboII GAAGA 1 cut(s) 245
MflI RGATCY 2 cut(s) 259, 284
MluCI AATT 2 cut(s) 114, 307
MnlI CCTC 3 cut(s) 147, 236, 249
MseI TTAA 2 cut(s) 173, 327
MwoI GCNNNNNNNGC 1 cut(s) 98
NdeII GATC 4 cut(s) 137, 250, 259, 284
NlaIII CATG 1 cut(s) 55
NlaIV GGNNCC 1 cut(s) 261
PfeI GAWTC 1 cut(s) 56
PflMI CCANNNNNTGG 1 cut(s) 52
PkrI GCNGC 1 cut(s) 37
PspN4I GGNNCC 1 cut(s) 261
PspPI GGNCC 1 cut(s) 122
PstI CTGCAG 1 cut(s) 40
PsuI RGATCY 2 cut(s) 259, 284
SaqAI TTAA 2 cut(s) 173, 327
SatI GCNGC 1 cut(s) 36
Sau3AI GATC 4 cut(s) 137, 250, 259, 284
Sau96I GGNCC 1 cut(s) 122
SetI ASST 2 cut(s) 20, 186
SfaNI GCATC 1 cut(s) 310
SfcI CTRYAG 1 cut(s) 36
SinI GGWCC 1 cut(s) 122
Sse9I AATT 2 cut(s) 114, 307
SspMI CTAG 2 cut(s) 93, 126
StyI CCWWGG 1 cut(s) 125
TasI AATT 2 cut(s) 114, 307
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 173, 327
Tru9I TTAA 2 cut(s) 173, 327
TseI GCWGC 1 cut(s) 35
Van91I CCANNNNNTGG 1 cut(s) 52
VpaK11BI GGWCC 1 cut(s) 122
XapI RAATTY 2 cut(s) 114, 307
XmaJI CCTAGG 1 cut(s) 125
XspI CTAG 2 cut(s) 93, 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.