Rh7AG298300

snRNA-activating protein complex

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
32629085 .. 32630697
1613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG298300.1

Sequence Viewer

Length: 189 bp
ATGAAGCCCAAGGTTGAAGAAACTGAGAATGTGATTTTGGACTCAAGAGAGAAGATTGAGTTCTATTGCACGAAAATGCAGGAACTTGATACATTCTACAACGATCTGAGGGATCCTTCTGCTTTTTCTTATAGTGGATCTATATTTGATTGGCTTAGAAATTCAAGAGATGATGCTCTTAAAAACTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.4

Weight (kDa)

4.62

Isoelectric Point (pI)

70.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 107, 120, 145
AcsI RAATTY 1 cut(s) 160
AgsI TTSAA 2 cut(s) 17, 165
AjuI GAANNNNNNNTTGG 2 cut(s) 20, 52
AlwI GGATC 3 cut(s) 107, 120, 145
ApoI RAATTY 1 cut(s) 160
BamHI GGATCC 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 114
BmsI GCATC 1 cut(s) 163
BpuEI CTTGAG 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 9
BseMII CTCAG 2 cut(s) 15, 98
Bsp143I GATC 3 cut(s) 103, 112, 137
BspCNI CTCAG 2 cut(s) 16, 99
BspLI GGNNCC 1 cut(s) 114
BspPI GGATC 3 cut(s) 107, 120, 145
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 3 cut(s) 103, 112, 137
BssT1I CCWWGG 1 cut(s) 9
BstDEI CTNAG 3 cut(s) 24, 107, 155
BstKTI GATC 3 cut(s) 106, 115, 140
BstMBI GATC 3 cut(s) 103, 112, 137
BstX2I RGATCY 2 cut(s) 112, 137
BstYI RGATCY 2 cut(s) 112, 137
CviJI RGCY 2 cut(s) 7, 154
CviKI_1 RGCY 2 cut(s) 7, 154
DdeI CTNAG 3 cut(s) 24, 107, 155
DpnI GATC 3 cut(s) 105, 114, 139
DpnII GATC 3 cut(s) 103, 112, 137
Eco130I CCWWGG 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaiI YATR 2 cut(s) 132, 143
FspEI CC 9 cut(s) 21, 22, 23, 65, 94, 95, 120, 129, 136
HinfI GANTC 1 cut(s) 41
Hpy188I TCNGA 1 cut(s) 108
Hpy188III TCNNGA 2 cut(s) 45, 165
HpyAV CCTTC 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 69, 79
HpyF3I CTNAG 3 cut(s) 24, 107, 155
Kzo9I GATC 3 cut(s) 103, 112, 137
LpnPI CCDG 1 cut(s) 65
LweI GCATC 1 cut(s) 163
MalI GATC 3 cut(s) 105, 114, 139
MboI GATC 3 cut(s) 103, 112, 137
MboII GAAGA 2 cut(s) 29, 64
MflI RGATCY 2 cut(s) 112, 137
MluCI AATT 1 cut(s) 160
MlyI GAGTC 1 cut(s) 35
MnlI CCTC 1 cut(s) 102
MseI TTAA 1 cut(s) 180
MslI CAYNNNNRTG 1 cut(s) 74
NdeII GATC 3 cut(s) 103, 112, 137
NlaIV GGNNCC 1 cut(s) 114
PleI GAGTC 1 cut(s) 35
PpsI GAGTC 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 114
PsuI RGATCY 2 cut(s) 112, 137
RseI CAYNNNNRTG 1 cut(s) 74
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 3 cut(s) 103, 112, 137
SchI GAGTC 1 cut(s) 35
SetI ASST 1 cut(s) 15
SfaNI GCATC 1 cut(s) 163
SgeI CNNG 6 cut(s) 22, 57, 82, 92, 98, 177
SmiMI CAYNNNNRTG 1 cut(s) 74
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 1 cut(s) 160
StyI CCWWGG 1 cut(s) 9
TasI AATT 1 cut(s) 160
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.