RchiOBHm_Chr6g0274621

Disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
36143637 .. 36143867
231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24636

Sequence Viewer

Length: 210 bp
ATGTTGTACAATGGAAGTGCTACTATTGATTTTGAGTGTCCTTCATTGGAAAACTTGGGTATCGAGGACTGCCCCAACTTGTCATTTCCATCCTCTGCTTCTAACTACTTCCACAGCAGGAAGCAAGTCCTTTTCAATGATCCTCTTTGTCTGAATCAGTTTCATATGAAAGTTATAGTACGTCGGGTCATAATTGGTAGGCTAGTTTGA

Protein Analysis

69

Amino Acids

7.86

Weight (kDa)

6.69

Isoelectric Point (pI)

49.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 134
AfaI GTAC 2 cut(s) 8, 180
AgsI TTSAA 1 cut(s) 136
AlwI GGATC 1 cut(s) 134
BaeI ACNNNNGTAYC 2 cut(s) 43, 76
BccI CCATC 1 cut(s) 97
BfaI CTAG 1 cut(s) 203
BseGI GGATG 1 cut(s) 89
Bsp1407I TGTACA 1 cut(s) 6
Bsp143I GATC 1 cut(s) 139
BspPI GGATC 1 cut(s) 134
BsrGI TGTACA 1 cut(s) 6
BssMI GATC 1 cut(s) 139
BstAUI TGTACA 1 cut(s) 6
BstF5I GGATG 1 cut(s) 89
BstKTI GATC 1 cut(s) 142
BstMBI GATC 1 cut(s) 139
BtsCI GGATG 1 cut(s) 89
Csp6I GTAC 2 cut(s) 7, 179
CviJI RGCY 1 cut(s) 202
CviKI_1 RGCY 1 cut(s) 202
CviQI GTAC 2 cut(s) 7, 179
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
FaiI YATR 4 cut(s) 165, 167, 176, 191
FauNDI CATATG 1 cut(s) 165
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 203
HinfI GANTC 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 153
Hpy99I CGWCG 1 cut(s) 186
HpyAV CCTTC 1 cut(s) 51
HpyCH4IV ACGT 1 cut(s) 181
HpySE526I ACGT 1 cut(s) 181
Kzo9I GATC 1 cut(s) 139
LpnPI CCDG 1 cut(s) 103
MaeI CTAG 1 cut(s) 203
MaeII ACGT 1 cut(s) 181
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MluCI AATT 1 cut(s) 192
MnlI CCTC 3 cut(s) 58, 103, 153
NdeI CATATG 1 cut(s) 165
NdeII GATC 1 cut(s) 139
PfeI GAWTC 1 cut(s) 154
RsaI GTAC 2 cut(s) 8, 180
RsaNI GTAC 2 cut(s) 7, 179
Sau3AI GATC 1 cut(s) 139
SetI ASST 1 cut(s) 184
SgeI CNNG 6 cut(s) 67, 76, 91, 130, 137, 197
Sse9I AATT 1 cut(s) 192
SspMI CTAG 1 cut(s) 203
TaiI ACGT 1 cut(s) 184
TaqI TCGA 1 cut(s) 63
TasI AATT 1 cut(s) 192
TatI WGTACW 1 cut(s) 6
TfiI GAWTC 1 cut(s) 154
TspDTI ATGAA 3 cut(s) 33, 152, 182
XspI CTAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.