Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7D

Orthogroup ID

OG0008836

Physical Location & Seq

Genomic Coordinates Reverse (-)

38390847 .. 38393575

Gene Structure 2729 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7DG321400.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 579 bp

ATGGAGCCTGAAATGATGCAGAGGGTGGTTGAATTCACGGGGAAGATGTCTCAAATCATACAGACGAAGCCCGAATTTGCAAAGAAGTTTTTACCTAGTTCGTTAGGGAAGCCTGAATTGTTGGAGATGATGCCTAGACTGATGGAGTTGCTTAATGGAATTTTGACAGAGAAGAATCCTGAATCGATGGAGAATCTTATAGCGTTGGCGAATATCACTCCTGATCTGATGAATCATATACCTGCTGAGATTAGTGAGATGATGGATCTGATGGCTAAATTGATGGAGGATACGAACTTTATCAAGTCCTTGCCTGGAATCGTGGAGAACATCCCTGGAATCATGAACTTGCCTCGAATCATAGAGGACTTTCCTCGATTGTTTGAGATTTTGCCAATGACTGGATCGGTGGAGAATATGCCTGGAATCATGGAGGACTTTGCTCAATTGATTGAGAATTCACCTCAGATGGCTGAATCGTTGAAGGACTTTGCTCAATCGGTTGAGAATTTTCTGAATTTGCCTCAAATGACTGAATGGATGGGAATCATGGAGAGCTTATCTCAGATGACTGAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

192

Amino Acids

21.86

Weight (kDa)

4.35

Isoelectric Point (pI)

52.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008836)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g05590
malus_domestica	MD15G1398400.v1.1
rosa_chinensis	RchiOBHm_Chr5g0079581 RchiOBHm_Chr6g0274621 RchiOBHm_Chr7g0212741
rosa_multiflora	Rmu_sc0000595.1_g000005 Rmu_sc0000595.1_g000014 Rmu_sc0000631.1_g000034 Rmu_sc0001148.1_g000042 Rmu_sc0003131.1_g000018 Rmu_sc0003450.1_g000005
rosa_roxburghii	Rroxscaffold_2G00110810 Rroxscaffold_3G00240350 Rroxscaffold_6G00412400 Rroxscaffold_7G00194710
rosa_rugosa	Rorug03G0098100
rosa_samantha	Rh7AG267900 Rh7CG286900 Rh7CG342200 Rh7DG321400
rosa_wichuraiana	Rw5G042570 Rw5G042580 Rw7G023120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	250
AccB7I	CCANNNNNTGG	1 cut(s)	401
AclWI	GGATC	2 cut(s)	273, 412
AcsI	RAATTY	6 cut(s)	32, 74, 159, 457, 508, 517
AfiI	CCNNNNNNNGG	1 cut(s)	401
AgsI	TTSAA	2 cut(s)	32, 484
AjnI	CCWGG	3 cut(s)	313, 334, 421
AluBI	AGCT	1 cut(s)	558
AluI	AGCT	1 cut(s)	558
Alw26I	GTCTC	1 cut(s)	54
AlwI	GGATC	2 cut(s)	273, 412
ApoI	RAATTY	6 cut(s)	32, 74, 159, 457, 508, 517
AsuHPI	GGTGA	1 cut(s)	453
BccI	CCATC	7 cut(s)	136, 181, 256, 265, 277, 463, 535
BciT130I	CCWGG	3 cut(s)	315, 336, 423
BciVI	GTATCC	1 cut(s)	283
BcoDI	GTCTC	1 cut(s)	54
BfaI	CTAG	2 cut(s)	96, 135
BfuAI	ACCTGC	1 cut(s)	250
BfuI	GTATCC	1 cut(s)	283
Bme1390I	CCNGG	3 cut(s)	315, 336, 423
BmiI	GGNNCC	1 cut(s)	6
BmrFI	CCNGG	3 cut(s)	315, 336, 423
BmsI	GCATC	2 cut(s)	6, 120
BplI	GAGNNNNNCTC	2 cut(s)	547, 579
Bsa29I	ATCGAT	1 cut(s)	185
BsaBI	GATNNNNATC	1 cut(s)	545
BsaJI	CCNNGG	1 cut(s)	334
Bsc4I	CCNNNNNNNGG	1 cut(s)	401
Bse1I	ACTGG	1 cut(s)	406
Bse8I	GATNNNNATC	1 cut(s)	545
BseBI	CCWGG	3 cut(s)	315, 336, 423
BseCI	ATCGAT	1 cut(s)	185
BseDI	CCNNGG	1 cut(s)	334
BseGI	GGATG	2 cut(s)	330, 546
BseJI	GATNNNNATC	1 cut(s)	545
BseLI	CCNNNNNNNGG	1 cut(s)	401
BseMII	CTCAG	3 cut(s)	237, 479, 578
BseNI	ACTGG	1 cut(s)	406
BshVI	ATCGAT	1 cut(s)	185
BslI	CCNNNNNNNGG	1 cut(s)	401
BsmAI	GTCTC	1 cut(s)	54
Bsp143I	GATC	3 cut(s)	223, 265, 404
BspCNI	CTCAG	3 cut(s)	238, 478, 577
BspDI	ATCGAT	1 cut(s)	185
BspHI	TCATGA	1 cut(s)	342
BspLI	GGNNCC	1 cut(s)	6
BspMI	ACCTGC	1 cut(s)	250
BspPI	GGATC	2 cut(s)	273, 412
BsrI	ACTGG	1 cut(s)	406
BssECI	CCNNGG	1 cut(s)	334
BssMI	GATC	3 cut(s)	223, 265, 404
Bst2UI	CCWGG	3 cut(s)	315, 336, 423
BstDEI	CTNAG	3 cut(s)	246, 465, 564
BstF5I	GGATG	2 cut(s)	330, 546
BstKTI	GATC	3 cut(s)	226, 268, 407
BstMAI	GTCTC	1 cut(s)	54
BstMBI	GATC	3 cut(s)	223, 265, 404
BstNI	CCWGG	3 cut(s)	315, 336, 423
BstSCI	CCNGG	3 cut(s)	313, 334, 421
BstX2I	RGATCY	1 cut(s)	265
BstYI	RGATCY	1 cut(s)	265
Bsu15I	ATCGAT	1 cut(s)	185
BsuI	GTATCC	1 cut(s)	283
BsuTUI	ATCGAT	1 cut(s)	185
BtsCI	GGATG	2 cut(s)	330, 546
BveI	ACCTGC	1 cut(s)	250
CciI	TCATGA	1 cut(s)	342
ClaI	ATCGAT	1 cut(s)	185
CviAII	CATG	3 cut(s)	343, 430, 550
CviJI	RGCY	6 cut(s)	7, 70, 112, 275, 473, 558
CviKI_1	RGCY	6 cut(s)	7, 70, 112, 275, 473, 558
DdeI	CTNAG	3 cut(s)	246, 465, 564
DpnI	GATC	3 cut(s)	225, 267, 406
DpnII	GATC	3 cut(s)	223, 265, 404
EcoRI	GAATTC	2 cut(s)	32, 457
EcoRII	CCWGG	3 cut(s)	313, 334, 421
FaeI	CATG	3 cut(s)	346, 433, 553
FaiI	YATR	9 cut(s)	59, 200, 237, 239, 344, 362, 419, 431, 551
FatI	CATG	3 cut(s)	342, 429, 549
FokI	GGATG	2 cut(s)	317, 553
FspBI	CTAG	2 cut(s)	96, 135
Hin1II	CATG	3 cut(s)	346, 433, 553
HphI	GGTGA	1 cut(s)	453
Hpy188I	TCNGA	5 cut(s)	228, 270, 468, 516, 567
Hpy188III	TCNNGA	3 cut(s)	179, 221, 343
HpyAV	CCTTC	1 cut(s)	478
HpyCH4V	TGCA	2 cut(s)	19, 80
HpyF3I	CTNAG	3 cut(s)	246, 465, 564
Hsp92II	CATG	3 cut(s)	346, 433, 553
Kzo9I	GATC	3 cut(s)	223, 265, 404
LmnI	GCTCC	1 cut(s)	4
LweI	GCATC	2 cut(s)	6, 120
MaeI	CTAG	2 cut(s)	96, 135
MalI	GATC	3 cut(s)	225, 267, 406
MboI	GATC	3 cut(s)	223, 265, 404
MboII	GAAGA	2 cut(s)	55, 184
MfeI	CAATTG	1 cut(s)	446
MflI	RGATCY	1 cut(s)	265
MluCI	AATT	9 cut(s)	32, 74, 116, 159, 278, 446, 457, 508, 517
MmeI	TCCRAC	1 cut(s)	102
MnlI	CCTC	8 cut(s)	15, 280, 358, 363, 384, 427, 474, 534
MseI	TTAA	1 cut(s)	153
MspR9I	CCNGG	3 cut(s)	315, 336, 423
MunI	CAATTG	1 cut(s)	446
MvaI	CCWGG	3 cut(s)	315, 336, 423
NdeII	GATC	3 cut(s)	223, 265, 404
NlaIII	CATG	3 cut(s)	346, 433, 553
NlaIV	GGNNCC	1 cut(s)	6
PagI	TCATGA	1 cut(s)	342
PflMI	CCANNNNNTGG	1 cut(s)	401
Psp6I	CCWGG	3 cut(s)	313, 334, 421
PspGI	CCWGG	3 cut(s)	313, 334, 421
PspN4I	GGNNCC	1 cut(s)	6
PsuI	RGATCY	1 cut(s)	265
SaqAI	TTAA	1 cut(s)	153
Sau3AI	GATC	3 cut(s)	223, 265, 404
ScrFI	CCNGG	3 cut(s)	315, 336, 423
SetI	ASST	4 cut(s)	97, 244, 466, 560
SfaNI	GCATC	2 cut(s)	6, 120
Sse9I	AATT	9 cut(s)	32, 74, 116, 159, 278, 446, 457, 508, 517
SspMI	CTAG	2 cut(s)	96, 135
StyD4I	CCNGG	3 cut(s)	313, 334, 421
TaqI	TCGA	3 cut(s)	185, 355, 376
TasI	AATT	9 cut(s)	32, 74, 116, 159, 278, 446, 457, 508, 517
Tru1I	TTAA	1 cut(s)	153
Tru9I	TTAA	1 cut(s)	153
TspDTI	ATGAA	2 cut(s)	245, 359
Van91I	CCANNNNNTGG	1 cut(s)	401
XapI	RAATTY	6 cut(s)	32, 74, 159, 457, 508, 517
XspI	CTAG	2 cut(s)	96, 135

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.