Rroxscaffold_7G00194710

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
36689934 .. 36707311
17378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00194710.1

Sequence Viewer

Length: 393 bp
ATGATTCATGACTCACCACCCCCTTTGGGCAATACTACGGAAAGATTTGGCACACCCCTATCAGCATGGGATACTCTCATCAAGTCACGTCTCAAGGTCGGGGAAAAGATCTTAACATCGATGGAGCCTAAAATGATGCAGAGGGTGGTTGAATTCACGGGGAAGATGTCTCAAATCATACGGACGAAGCCCGAATTTGCAAAGAAGTTTTTTCCTAGTTCGTTAGCAAAGCCTGAATTGTTGGAGATGATGCCTCGACCGATGGAGTTGCTTAATGGAAGTTTGACGAGAGAAGAATCCCGAATCGATGGAGAATCTTATAGCATTGGTGAATATCACTCCGATCCGATGAATCATATACTTGCCGAGATTAGTGAGATGATGGATCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

130

Amino Acids

14.87

Weight (kDa)

5.94

Isoelectric Point (pI)

46.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 338
AcsI RAATTY 2 cut(s) 152, 194
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 152
AjiI CACGTC 1 cut(s) 89
Alw26I GTCTC 2 cut(s) 95, 174
AlwI GGATC 1 cut(s) 338
ApoI RAATTY 2 cut(s) 152, 194
AsuHPI GGTGA 2 cut(s) 6, 341
BccI CCATC 4 cut(s) 115, 256, 302, 376
BcgI CGANNNNNNTGC 2 cut(s) 250, 284
BciVI GTATCC 1 cut(s) 64
BcoDI GTCTC 2 cut(s) 95, 174
BfaI CTAG 1 cut(s) 216
BfuI GTATCC 1 cut(s) 64
BglII AGATCT 1 cut(s) 108
BmgBI CACGTC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 126
BmsI GCATC 2 cut(s) 126, 240
BpuEI CTTGAG 1 cut(s) 77
Bsa29I ATCGAT 3 cut(s) 119, 306, 388
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseCI ATCGAT 3 cut(s) 119, 306, 388
BseLI CCNNNNNNNGG 1 cut(s) 26
Bsh1285I CGRYCG 1 cut(s) 260
BshVI ATCGAT 3 cut(s) 119, 306, 388
BsiEI CGRYCG 1 cut(s) 260
BslI CCNNNNNNNGG 1 cut(s) 26
BsmAI GTCTC 2 cut(s) 95, 174
BsmBI CGTCTC 1 cut(s) 95
Bsp143I GATC 3 cut(s) 108, 343, 385
BspDI ATCGAT 3 cut(s) 119, 306, 388
BspHI TCATGA 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 126
BspPI GGATC 1 cut(s) 338
BssMI GATC 3 cut(s) 108, 343, 385
BstKTI GATC 3 cut(s) 111, 346, 388
BstMAI GTCTC 2 cut(s) 95, 174
BstMBI GATC 3 cut(s) 108, 343, 385
BstMCI CGRYCG 1 cut(s) 260
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
Bsu15I ATCGAT 3 cut(s) 119, 306, 388
BsuI GTATCC 1 cut(s) 64
BsuTUI ATCGAT 3 cut(s) 119, 306, 388
BtrI CACGTC 1 cut(s) 89
CciI TCATGA 1 cut(s) 7
ClaI ATCGAT 3 cut(s) 119, 306, 388
CspCI CAANNNNNGTGG 2 cut(s) 6, 41
CviAII CATG 2 cut(s) 8, 66
CviJI RGCY 3 cut(s) 127, 190, 232
CviKI_1 RGCY 3 cut(s) 127, 190, 232
DpnI GATC 3 cut(s) 110, 345, 387
DpnII GATC 3 cut(s) 108, 343, 385
EcoRI GAATTC 1 cut(s) 152
Esp3I CGTCTC 1 cut(s) 95
FaeI CATG 2 cut(s) 11, 69
FaiI YATR 6 cut(s) 9, 67, 179, 321, 357, 359
FatI CATG 2 cut(s) 7, 65
FspBI CTAG 1 cut(s) 216
Hin1II CATG 2 cut(s) 11, 69
HinfI GANTC 6 cut(s) 4, 11, 296, 303, 314, 352
HphI GGTGA 2 cut(s) 6, 341
Hpy188I TCNGA 2 cut(s) 343, 348
Hpy188III TCNNGA 2 cut(s) 8, 300
HpyCH4IV ACGT 1 cut(s) 88
HpyCH4V TGCA 2 cut(s) 139, 200
HpySE526I ACGT 1 cut(s) 88
Hsp92II CATG 2 cut(s) 11, 69
Kzo9I GATC 3 cut(s) 108, 343, 385
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 1 cut(s) 246
LweI GCATC 2 cut(s) 126, 240
MaeI CTAG 1 cut(s) 216
MaeII ACGT 1 cut(s) 88
MaeIII GTNAC 1 cut(s) 84
MalI GATC 3 cut(s) 110, 345, 387
MboI GATC 3 cut(s) 108, 343, 385
MboII GAAGA 2 cut(s) 175, 305
MflI RGATCY 1 cut(s) 108
MluCI AATT 3 cut(s) 152, 194, 236
MlyI GAGTC 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 222
MnlI CCTC 2 cut(s) 135, 264
MseI TTAA 2 cut(s) 113, 273
NdeII GATC 3 cut(s) 108, 343, 385
NlaIII CATG 2 cut(s) 11, 69
NlaIV GGNNCC 1 cut(s) 126
NmeAIII GCCGAG 1 cut(s) 391
NmuCI GTSAC 1 cut(s) 84
PagI TCATGA 1 cut(s) 7
PfeI GAWTC 5 cut(s) 4, 296, 303, 314, 352
PleI GAGTC 1 cut(s) 5
PpsI GAGTC 1 cut(s) 5
PspN4I GGNNCC 1 cut(s) 126
PsuI RGATCY 1 cut(s) 108
SaqAI TTAA 2 cut(s) 113, 273
Sau3AI GATC 3 cut(s) 108, 343, 385
SchI GAGTC 1 cut(s) 5
SetI ASST 2 cut(s) 91, 99
SfaNI GCATC 2 cut(s) 126, 240
SmlI CTYRAG 1 cut(s) 92
SmoI CTYRAG 1 cut(s) 92
Sse9I AATT 3 cut(s) 152, 194, 236
SspMI CTAG 1 cut(s) 216
TaiI ACGT 1 cut(s) 91
TaqI TCGA 4 cut(s) 119, 256, 306, 388
TaqII GACCGA 1 cut(s) 274
TasI AATT 3 cut(s) 152, 194, 236
TfiI GAWTC 5 cut(s) 4, 296, 303, 314, 352
Tru1I TTAA 2 cut(s) 113, 273
Tru9I TTAA 2 cut(s) 113, 273
TseFI GTSAC 1 cut(s) 84
Tsp45I GTSAC 1 cut(s) 84
TspDTI ATGAA 1 cut(s) 365
TspGWI ACGGA 2 cut(s) 53, 196
XapI RAATTY 2 cut(s) 152, 194
XspI CTAG 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.