Rroxscaffold_3G00240350

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
32049827 .. 32050249
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00240350.1

Sequence Viewer

Length: 423 bp
ATGTCTCAAATCATACAGACGAAGCCCGAATTTGCAAAGAAGTTTTTACCTAGTTCGTTAGCAAAGCCTGAATTGTTGGAGATGATGCCTAGACCGATGGAGTTGCTGAATGGAATTTTGACAGAGAAGAATCCCGAATCGATGGAGAATCTTATAGCGTTGGCGAATATCACTCCCGATCCGATGAATCATATACCCGCCGAGATTAGTGAGATGATGGAACTGATGACTAAATTGATGGAGGATACGAACTTTATCAAGTCCTTGCCCGGAATCGTGGAGAACATCCCTGGAATCATGAACTTGCCTCGAATCATAGAGGACTTTCCTCGATTGTTTGAGATTTTGCCAATGACCGGATCGGTGGAGAATATGCCTGGAATCATGGAGGACTTTGCTAAATTGATTGAGAATTCGCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

15.81

Weight (kDa)

4.51

Isoelectric Point (pI)

52.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 198
AclWI GGATC 2 cut(s) 173, 367
AcsI RAATTY 3 cut(s) 29, 114, 412
AfiI CCNNNNNNNGG 1 cut(s) 356
AjnI CCWGG 2 cut(s) 289, 376
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 2 cut(s) 173, 367
ApoI RAATTY 3 cut(s) 29, 114, 412
AsuC2I CCSGG 1 cut(s) 270
BccI CCATC 4 cut(s) 91, 136, 211, 232
BcgI CGANNNNNNTGC 2 cut(s) 85, 119
BciT130I CCWGG 2 cut(s) 291, 378
BciVI GTATCC 1 cut(s) 238
BcnI CCSGG 1 cut(s) 270
BcoDI GTCTC 1 cut(s) 9
BfaI CTAG 2 cut(s) 51, 90
BfuI GTATCC 1 cut(s) 238
Bme1390I CCNGG 3 cut(s) 270, 291, 378
BmrFI CCNGG 3 cut(s) 270, 291, 378
BmsI GCATC 1 cut(s) 75
BpuMI CCSGG 1 cut(s) 270
Bsa29I ATCGAT 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 289
BsaWI WCCGGW 1 cut(s) 356
Bsc4I CCNNNNNNNGG 1 cut(s) 356
BseBI CCWGG 2 cut(s) 291, 378
BseCI ATCGAT 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 289
BseGI GGATG 1 cut(s) 285
BseLI CCNNNNNNNGG 1 cut(s) 356
BshVI ATCGAT 1 cut(s) 140
BsiSI CCGG 2 cut(s) 270, 357
BslI CCNNNNNNNGG 1 cut(s) 356
BsmAI GTCTC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 178, 359
BspACI CCGC 1 cut(s) 198
BspDI ATCGAT 1 cut(s) 140
BspHI TCATGA 1 cut(s) 297
BspPI GGATC 2 cut(s) 173, 367
BssECI CCNNGG 1 cut(s) 289
BssMI GATC 2 cut(s) 178, 359
Bst2UI CCWGG 2 cut(s) 291, 378
BstDEI CTNAG 1 cut(s) 420
BstF5I GGATG 1 cut(s) 285
BstKTI GATC 2 cut(s) 181, 362
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 2 cut(s) 178, 359
BstNI CCWGG 2 cut(s) 291, 378
BstSCI CCNGG 3 cut(s) 268, 289, 376
Bsu15I ATCGAT 1 cut(s) 140
BsuI GTATCC 1 cut(s) 238
BsuTUI ATCGAT 1 cut(s) 140
BtsCI GGATG 1 cut(s) 285
CciI TCATGA 1 cut(s) 297
ClaI ATCGAT 1 cut(s) 140
CviAII CATG 2 cut(s) 298, 385
CviJI RGCY 2 cut(s) 25, 67
CviKI_1 RGCY 2 cut(s) 25, 67
DdeI CTNAG 1 cut(s) 420
DpnI GATC 2 cut(s) 180, 361
DpnII GATC 2 cut(s) 178, 359
EcoRI GAATTC 1 cut(s) 412
EcoRII CCWGG 2 cut(s) 289, 376
FaeI CATG 2 cut(s) 301, 388
FaiI YATR 8 cut(s) 14, 155, 192, 194, 299, 317, 374, 386
FatI CATG 2 cut(s) 297, 384
FauI CCCGC 1 cut(s) 205
FokI GGATG 1 cut(s) 272
FspBI CTAG 2 cut(s) 51, 90
HapII CCGG 2 cut(s) 270, 357
Hin1II CATG 2 cut(s) 301, 388
HinfI GANTC 8 cut(s) 130, 137, 148, 187, 273, 294, 312, 381
HpaII CCGG 2 cut(s) 270, 357
Hpy188I TCNGA 1 cut(s) 183
Hpy188III TCNNGA 3 cut(s) 134, 176, 298
HpyCH4V TGCA 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 420
Hsp92II CATG 2 cut(s) 301, 388
Kzo9I GATC 2 cut(s) 178, 359
LpnPI CCDG 7 cut(s) 81, 276, 283, 303, 363, 370, 390
LweI GCATC 1 cut(s) 75
MaeI CTAG 2 cut(s) 51, 90
MalI GATC 2 cut(s) 180, 361
MboI GATC 2 cut(s) 178, 359
MboII GAAGA 1 cut(s) 139
MluCI AATT 6 cut(s) 29, 71, 114, 233, 401, 412
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 5 cut(s) 235, 313, 318, 339, 382
MspI CCGG 2 cut(s) 270, 357
MspR9I CCNGG 3 cut(s) 270, 291, 378
MvaI CCWGG 2 cut(s) 291, 378
NciI CCSGG 1 cut(s) 270
NdeII GATC 2 cut(s) 178, 359
NlaIII CATG 2 cut(s) 301, 388
NmeAIII GCCGAG 1 cut(s) 226
PagI TCATGA 1 cut(s) 297
PfeI GAWTC 8 cut(s) 130, 137, 148, 187, 273, 294, 312, 381
Psp6I CCWGG 2 cut(s) 289, 376
PspGI CCWGG 2 cut(s) 289, 376
Sau3AI GATC 2 cut(s) 178, 359
ScrFI CCNGG 3 cut(s) 270, 291, 378
SetI ASST 1 cut(s) 52
SfaNI GCATC 1 cut(s) 75
Sse9I AATT 6 cut(s) 29, 71, 114, 233, 401, 412
SsiI CCGC 1 cut(s) 198
SspMI CTAG 2 cut(s) 51, 90
StyD4I CCNGG 3 cut(s) 268, 289, 376
TaqI TCGA 3 cut(s) 140, 310, 331
TaqII GACCGA 1 cut(s) 109
TasI AATT 6 cut(s) 29, 71, 114, 233, 401, 412
TfiI GAWTC 8 cut(s) 130, 137, 148, 187, 273, 294, 312, 381
TspDTI ATGAA 2 cut(s) 200, 314
XapI RAATTY 3 cut(s) 29, 114, 412
XspI CTAG 2 cut(s) 51, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.