RchiOBHm_Chr7g0232011

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
55896320 .. 55896475
156 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20793

Sequence Viewer

Length: 156 bp
ATGACCCAAGAAATTAATCAAACCCTCCGGGCAGATATGGAGGAAGTACACGAGCCTGCAGTCAAGTACAGAGGCGTACGCAAGCGAAAATGGGGTAAATGGGTGTCCGAAATCCGGGAACCGGGAAAGAAAACCCGGATATGGCTCGGAAGCTAG

Protein Analysis

51

Amino Acids

6.11

Weight (kDa)

10.11

Isoelectric Point (pI)

37.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AP2 PF00847 22 - 50 3.5e-06 AP2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 3 cut(s) 48, 68, 78
AfiI CCNNNNNNNGG 3 cut(s) 114, 121, 141
AluBI AGCT 1 cut(s) 153
AluI AGCT 1 cut(s) 153
AseI ATTAAT 1 cut(s) 15
AsuC2I CCSGG 4 cut(s) 29, 116, 123, 136
BauI CACGAG 1 cut(s) 50
BcnI CCSGG 4 cut(s) 29, 116, 123, 136
BfaI CTAG 1 cut(s) 154
BfmI CTRYAG 1 cut(s) 57
Bme1390I CCNGG 4 cut(s) 29, 116, 123, 136
BmiI GGNNCC 1 cut(s) 120
BmrFI CCNGG 4 cut(s) 29, 116, 123, 136
BpuMI CCSGG 4 cut(s) 29, 116, 123, 136
Bsc4I CCNNNNNNNGG 3 cut(s) 114, 121, 141
BseLI CCNNNNNNNGG 3 cut(s) 114, 121, 141
BsiSI CCGG 4 cut(s) 28, 115, 122, 136
BsiWI CGTACG 1 cut(s) 76
BslI CCNNNNNNNGG 3 cut(s) 114, 121, 141
BspLI GGNNCC 1 cut(s) 120
BspMAI CTGCAG 1 cut(s) 61
BssSI CACGAG 1 cut(s) 50
Bst2BI CACGAG 1 cut(s) 50
BstC8I GCNNGC 2 cut(s) 57, 83
BstSCI CCNGG 4 cut(s) 27, 114, 121, 134
BstSFI CTRYAG 1 cut(s) 57
Cac8I GCNNGC 2 cut(s) 57, 83
Csp6I GTAC 3 cut(s) 47, 67, 77
CviJI RGCY 3 cut(s) 55, 145, 153
CviKI_1 RGCY 3 cut(s) 55, 145, 153
CviQI GTAC 3 cut(s) 47, 67, 77
FaiI YATR 2 cut(s) 38, 142
FspBI CTAG 1 cut(s) 154
HapII CCGG 4 cut(s) 28, 115, 122, 136
HpaII CCGG 4 cut(s) 28, 115, 122, 136
Hpy166II GTNNAC 1 cut(s) 49
Hpy188I TCNGA 2 cut(s) 109, 149
Hpy8I GTNNAC 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 59
LpnPI CCDG 5 cut(s) 41, 69, 128, 135, 149
MaeI CTAG 1 cut(s) 154
MluCI AATT 1 cut(s) 12
MnlI CCTC 3 cut(s) 34, 35, 65
MseI TTAA 1 cut(s) 15
MspI CCGG 4 cut(s) 28, 115, 122, 136
MspR9I CCNGG 4 cut(s) 29, 116, 123, 136
NciI CCSGG 4 cut(s) 29, 116, 123, 136
NlaIV GGNNCC 1 cut(s) 120
Pfl23II CGTACG 1 cut(s) 76
PfoI TCCNGGA 1 cut(s) 114
PshBI ATTAAT 1 cut(s) 15
PspLI CGTACG 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 120
PstI CTGCAG 1 cut(s) 61
RsaI GTAC 3 cut(s) 48, 68, 78
RsaNI GTAC 3 cut(s) 47, 67, 77
SaqAI TTAA 1 cut(s) 15
ScrFI CCNGG 4 cut(s) 29, 116, 123, 136
SetI ASST 1 cut(s) 155
SfcI CTRYAG 1 cut(s) 57
Sse9I AATT 1 cut(s) 12
SspMI CTAG 1 cut(s) 154
StyD4I CCNGG 4 cut(s) 27, 114, 121, 134
TasI AATT 1 cut(s) 12
TatI WGTACW 2 cut(s) 46, 66
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
VspI ATTAAT 1 cut(s) 15
XspI CTAG 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.