Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004618.1

Orthogroup ID

OG0005624

Physical Location & Seq

Genomic Coordinates Reverse (-)

154826 .. 155374

Gene Structure 549 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004618.1_g000040.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 549 bp

atggaggaagtacacgagcctgcagtcaagtacagaggtgtacgcaagcgaaaatggggtaagtgggtgtccgaaatccgggaacctggaaagaaaacccggatatggctaggaagctacgaggcccccgaaatggccgccgccgcctacgatgctgcggcattgcacctcagaggaccaggggtcctgcttaactttcctgaaatggttgatagtcttccgaggccagcgagttcgagtccctcggacgtgcagttgacggctcaagaggcggcaatgaggtttaggagactgccaatggggtcggtttcgacggaggtggctggtggctcgagtggtggcgcggcgccggtgacggtgggactgtcgccgagtcaaattcaggcgattaatgagtcgccattagactcgcctaagatgtggatgcagtacatgtacatgtctcatcgtgatgaggctttgttttttggggaggacatgccatcgtctatgggtttctatgatgatcacgatgagggtttgcagcatcagtccatttgggactcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

182

Amino Acids

20.15

Weight (kDa)

5.36

Isoelectric Point (pI)

74.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005624)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G33760
fragaria_vesca	FvH4_5g33240
malus_domestica	MD15G1396500.v1.1
prunus_persica	Prupe.1G545400_v2.0.a1
pyrus_communis	pycom15g35660
rosa_chinensis	RchiOBHm_Chr7g0231641 RchiOBHm_Chr7g0231741 RchiOBHm_Chr7g0231821 RchiOBHm_Chr7g0231881 RchiOBHm_Chr7g0231901 RchiOBHm_Chr7g0231921 RchiOBHm_Chr7g0232011 RchiOBHm_Chr7g0232021
rosa_laevigata	RLG00000001403
rosa_multiflora	Rmu_sc0003063.1_g000014 Rmu_sc0004618.1_g000040
rosa_roxburghii	Rroxscaffold_3G00228920 Rroxscaffold_3G00228940 Rroxscaffold_3G00228980
rosa_rugosa	Rorug07G0267800 Rorug07G0267900 Rorug07G0268300
rosa_samantha	Rh7AG422500 Rh7BG396800 Rh7BG396900 Rh7CG442700 Rh7DG414800
rosa_wichuraiana	Rw7G034830

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	346
AccII	CGCG	1 cut(s)	344
AciI	CCGC	6 cut(s)	138, 141, 144, 158, 272, 344
AcoI	YGGCCR	1 cut(s)	135
AcsI	RAATTY	1 cut(s)	378
AcyI	GRCGYC	1 cut(s)	347
AfaI	GTAC	5 cut(s)	12, 32, 42, 431, 437
AfiI	CCNNNNNNNGG	3 cut(s)	78, 105, 133
AflIII	ACRYGT	2 cut(s)	432, 438
AhdI	GACNNNNNGTC	1 cut(s)	182
AjiI	CACGTC	1 cut(s)	250
AjnI	CCWGG	2 cut(s)	85, 178
AluBI	AGCT	1 cut(s)	117
AluI	AGCT	1 cut(s)	117
Alw26I	GTCTC	2 cut(s)	283, 447
Ama87I	CYCGRG	1 cut(s)	331
AoxI	GGCC	3 cut(s)	123, 135, 224
ApeKI	GCWGC	2 cut(s)	155, 523
ApoI	RAATTY	1 cut(s)	378
AseI	ATTAAT	1 cut(s)	390
AspLEI	GCGC	2 cut(s)	344, 349
AspS9I	GGNCC	3 cut(s)	124, 176, 184
AsuC2I	CCSGG	2 cut(s)	80, 100
AsuHPI	GGTGA	1 cut(s)	364
AvaI	CYCGRG	1 cut(s)	331
AvaII	GGWCC	2 cut(s)	176, 184
BanI	GGYRCC	1 cut(s)	346
BauI	CACGAG	1 cut(s)	14
BbsI	GAAGAC	1 cut(s)	209
BbvI	GCAGC	2 cut(s)	142, 535
BccI	CCATC	1 cut(s)	490
BceAI	ACGGC	1 cut(s)	276
BciT130I	CCWGG	2 cut(s)	87, 180
BclI	TGATCA	1 cut(s)	505
BcnI	CCSGG	2 cut(s)	80, 100
BcoDI	GTCTC	2 cut(s)	283, 447
BfaI	CTAG	2 cut(s)	110, 547
BfmI	CTRYAG	1 cut(s)	21
BfoI	RGCGCY	1 cut(s)	350
BisI	GCNGC	8 cut(s)	138, 141, 144, 156, 159, 273, 345, 524
BlsI	GCNGC	8 cut(s)	139, 142, 145, 157, 160, 274, 346, 525
Bme1390I	CCNGG	4 cut(s)	80, 87, 100, 180
Bme18I	GGWCC	2 cut(s)	176, 184
BmeRI	GACNNNNNGTC	1 cut(s)	182
BmeT110I	CYCGRG	1 cut(s)	331
BmgBI	CACGTC	1 cut(s)	250
BmgT120I	GGNCC	3 cut(s)	124, 176, 184
BmiI	GGNNCC	4 cut(s)	84, 126, 185, 348
BmrFI	CCNGG	4 cut(s)	80, 87, 100, 180
BmsI	GCATC	3 cut(s)	142, 414, 535
BpiI	GAAGAC	1 cut(s)	209
BpuEI	CTTGAG	1 cut(s)	249
BpuMI	CCSGG	2 cut(s)	80, 100
BsaHI	GRCGYC	1 cut(s)	347
BsaJI	CCNNGG	3 cut(s)	179, 221, 243
Bsc4I	CCNNNNNNNGG	3 cut(s)	78, 105, 133
Bse118I	RCCGGY	1 cut(s)	349
Bse3DI	GCAATG	2 cut(s)	161, 282
BseBI	CCWGG	2 cut(s)	87, 180
BseDI	CCNNGG	3 cut(s)	179, 221, 243
BseGI	GGATG	1 cut(s)	429
BseLI	CCNNNNNNNGG	3 cut(s)	78, 105, 133
BseMI	GCAATG	2 cut(s)	161, 282
BseMII	CTCAG	1 cut(s)	184
BseXI	GCAGC	2 cut(s)	142, 535
BsgI	GTGCAG	1 cut(s)	272
Bsh1236I	CGCG	1 cut(s)	344
BshFI	GGCC	3 cut(s)	125, 137, 226
BshNI	GGYRCC	1 cut(s)	346
BsiHKCI	CYCGRG	1 cut(s)	331
BsiSI	CCGG	3 cut(s)	79, 100, 350
BslFI	GGGAC	2 cut(s)	225, 375
BslI	CCNNNNNNNGG	3 cut(s)	78, 105, 133
BsmAI	GTCTC	2 cut(s)	283, 447
BsmFI	GGGAC	2 cut(s)	225, 375
BsnI	GGCC	3 cut(s)	125, 137, 226
BsoBI	CYCGRG	1 cut(s)	331
Bsp1407I	TGTACA	1 cut(s)	435
Bsp143I	GATC	1 cut(s)	505
BspACI	CCGC	6 cut(s)	138, 141, 144, 158, 272, 344
BspANI	GGCC	3 cut(s)	125, 137, 226
BspCNI	CTCAG	1 cut(s)	183
BspFNI	CGCG	1 cut(s)	344
BspLI	GGNNCC	4 cut(s)	84, 126, 185, 348
BspMAI	CTGCAG	1 cut(s)	25
BspT107I	GGYRCC	1 cut(s)	346
BsrDI	GCAATG	2 cut(s)	161, 282
BsrFI	RCCGGY	1 cut(s)	349
BsrGI	TGTACA	1 cut(s)	435
BssAI	RCCGGY	1 cut(s)	349
BssECI	CCNNGG	3 cut(s)	179, 221, 243
BssMI	GATC	1 cut(s)	505
BssNI	GRCGYC	1 cut(s)	347
BssSI	CACGAG	1 cut(s)	14
Bst2BI	CACGAG	1 cut(s)	14
Bst2UI	CCWGG	2 cut(s)	87, 180
Bst4CI	ACNGT	2 cut(s)	358, 366
BstACI	GRCGYC	1 cut(s)	347
BstAUI	TGTACA	1 cut(s)	435
BstC8I	GCNNGC	3 cut(s)	21, 47, 228
BstDEI	CTNAG	2 cut(s)	170, 414
BstF5I	GGATG	1 cut(s)	429
BstFNI	CGCG	1 cut(s)	344
BstH2I	RGCGCY	1 cut(s)	350
BstHHI	GCGC	2 cut(s)	344, 349
BstKTI	GATC	1 cut(s)	508
BstMAI	GTCTC	2 cut(s)	283, 447
BstMBI	GATC	1 cut(s)	505
BstMWI	GCNNNNNNNGC	3 cut(s)	143, 152, 269
BstNI	CCWGG	2 cut(s)	87, 180
BstNSI	RCATGY	3 cut(s)	436, 442, 481
BstSCI	CCNGG	4 cut(s)	78, 85, 98, 178
BstSFI	CTRYAG	1 cut(s)	21
BstUI	CGCG	1 cut(s)	344
BstV1I	GCAGC	2 cut(s)	142, 535
BstV2I	GAAGAC	1 cut(s)	209
BsuRI	GGCC	3 cut(s)	125, 137, 226
BtrI	CACGTC	1 cut(s)	250
BtsCI	GGATG	1 cut(s)	429
Cac8I	GCNNGC	3 cut(s)	21, 47, 228
CfoI	GCGC	2 cut(s)	344, 349
Cfr10I	RCCGGY	1 cut(s)	349
Cfr13I	GGNCC	3 cut(s)	124, 176, 184
Csp6I	GTAC	5 cut(s)	11, 31, 41, 430, 436
CviAII	CATG	3 cut(s)	433, 439, 478
CviQI	GTAC	5 cut(s)	11, 31, 41, 430, 436
DdeI	CTNAG	2 cut(s)	170, 414
DinI	GGCGCC	1 cut(s)	348
DpnI	GATC	1 cut(s)	507
DpnII	GATC	1 cut(s)	505
DriI	GACNNNNNGTC	1 cut(s)	182
EaeI	YGGCCR	1 cut(s)	135
Eam1105I	GACNNNNNGTC	1 cut(s)	182
Eco47I	GGWCC	2 cut(s)	176, 184
Eco88I	CYCGRG	1 cut(s)	331
EcoO109I	RGGNCCY	2 cut(s)	124, 184
EcoRII	CCWGG	2 cut(s)	85, 178
EgeI	GGCGCC	1 cut(s)	348
EheI	GGCGCC	1 cut(s)	348
FaeI	CATG	3 cut(s)	436, 442, 481
FaiI	YATR	6 cut(s)	106, 434, 440, 479, 491, 501
FaqI	GGGAC	2 cut(s)	225, 375
FatI	CATG	3 cut(s)	432, 438, 477
FbaI	TGATCA	1 cut(s)	505
Fnu4HI	GCNGC	8 cut(s)	138, 141, 144, 156, 159, 273, 345, 524
FokI	GGATG	1 cut(s)	436
Fsp4HI	GCNGC	8 cut(s)	138, 141, 144, 156, 159, 273, 345, 524
FspBI	CTAG	2 cut(s)	110, 547
GlaI	GCGC	2 cut(s)	343, 348
GluI	GCNGC	8 cut(s)	138, 141, 144, 156, 159, 273, 345, 524
HaeII	RGCGCY	1 cut(s)	350
HaeIII	GGCC	3 cut(s)	125, 137, 226
HapII	CCGG	3 cut(s)	79, 100, 350
HhaI	GCGC	2 cut(s)	344, 349
Hin1I	GRCGYC	1 cut(s)	347
Hin1II	CATG	3 cut(s)	436, 442, 481
Hin6I	GCGC	2 cut(s)	342, 347
HinP1I	GCGC	2 cut(s)	342, 347
HincII	GTYRAC	1 cut(s)	258
HindII	GTYRAC	1 cut(s)	258
HinfI	GANTC	5 cut(s)	238, 373, 395, 407, 542
HpaII	CCGG	3 cut(s)	79, 100, 350
HphI	GGTGA	1 cut(s)	364
Hpy166II	GTNNAC	3 cut(s)	13, 41, 258
Hpy188I	TCNGA	4 cut(s)	73, 173, 222, 247
Hpy188III	TCNNGA	4 cut(s)	200, 266, 449, 509
Hpy8I	GTNNAC	3 cut(s)	13, 41, 258
Hpy99I	CGWCG	1 cut(s)	316
HpyCH4III	ACNGT	2 cut(s)	358, 366
HpyCH4IV	ACGT	1 cut(s)	249
HpyCH4V	TGCA	5 cut(s)	23, 166, 253, 427, 523
HpyF10VI	GCNNNNNNNGC	3 cut(s)	143, 152, 269
HpyF3I	CTNAG	2 cut(s)	170, 414
HpySE526I	ACGT	1 cut(s)	249
Hsp92I	GRCGYC	1 cut(s)	347
Hsp92II	CATG	3 cut(s)	436, 442, 481
HspAI	GCGC	2 cut(s)	342, 347
KasI	GGCGCC	1 cut(s)	346
Ksp22I	TGATCA	1 cut(s)	505
Kzo9I	GATC	1 cut(s)	505
Lsp1109I	GCAGC	2 cut(s)	142, 535
LweI	GCATC	3 cut(s)	142, 414, 535
MaeI	CTAG	2 cut(s)	110, 547
MaeII	ACGT	1 cut(s)	249
MaeIII	GTNAC	1 cut(s)	352
MalI	GATC	1 cut(s)	507
MboI	GATC	1 cut(s)	505
MboII	GAAGA	1 cut(s)	209
MluCI	AATT	1 cut(s)	378
Mly113I	GGCGCC	1 cut(s)	347
MlyI	GAGTC	5 cut(s)	247, 382, 401, 404, 536
MseI	TTAA	2 cut(s)	192, 390
MslI	CAYNNNNRTG	2 cut(s)	437, 450
MspI	CCGG	3 cut(s)	79, 100, 350
MspR9I	CCNGG	4 cut(s)	80, 87, 100, 180
MteI	GCGCNGCGC	1 cut(s)	345
MvaI	CCWGG	2 cut(s)	87, 180
MvnI	CGCG	1 cut(s)	344
MwoI	GCNNNNNNNGC	3 cut(s)	143, 152, 269
NarI	GGCGCC	1 cut(s)	347
NciI	CCSGG	2 cut(s)	80, 100
NdeII	GATC	1 cut(s)	505
NlaIII	CATG	3 cut(s)	436, 442, 481
NlaIV	GGNNCC	4 cut(s)	84, 126, 185, 348
NmeAIII	GCCGAG	1 cut(s)	396
NmuCI	GTSAC	1 cut(s)	352
NspI	RCATGY	3 cut(s)	436, 442, 481
PaeR7I	CTCGAG	1 cut(s)	331
PciI	ACATGT	2 cut(s)	432, 438
PcsI	WCGNNNNNNNCGW	1 cut(s)	126
PfoI	TCCNGGA	1 cut(s)	78
PkrI	GCNGC	8 cut(s)	139, 142, 145, 157, 160, 274, 346, 525
PleI	GAGTC	5 cut(s)	246, 381, 401, 403, 536
PluTI	GGCGCC	1 cut(s)	350
PpsI	GAGTC	5 cut(s)	246, 381, 401, 403, 536
PpuMI	RGGWCCY	1 cut(s)	184
PscI	ACATGT	2 cut(s)	432, 438
PshBI	ATTAAT	1 cut(s)	390
Psp5II	RGGWCCY	1 cut(s)	184
Psp6I	CCWGG	2 cut(s)	85, 178
PspGI	CCWGG	2 cut(s)	85, 178
PspN4I	GGNNCC	4 cut(s)	84, 126, 185, 348
PspPI	GGNCC	3 cut(s)	124, 176, 184
PspPPI	RGGWCCY	1 cut(s)	184
PspXI	VCTCGAGB	1 cut(s)	331
PstI	CTGCAG	1 cut(s)	25
RsaI	GTAC	5 cut(s)	12, 32, 42, 431, 437
RsaNI	GTAC	5 cut(s)	11, 31, 41, 430, 436
RseI	CAYNNNNRTG	2 cut(s)	437, 450
SaqAI	TTAA	2 cut(s)	192, 390
SatI	GCNGC	8 cut(s)	138, 141, 144, 156, 159, 273, 345, 524
Sau3AI	GATC	1 cut(s)	505
Sau96I	GGNCC	3 cut(s)	124, 176, 184
SchI	GAGTC	5 cut(s)	247, 382, 401, 404, 536
ScrFI	CCNGG	4 cut(s)	80, 87, 100, 180
SetI	ASST	7 cut(s)	40, 88, 119, 171, 252, 284, 321
SfaNI	GCATC	3 cut(s)	142, 414, 535
SfcI	CTRYAG	1 cut(s)	21
SfoI	GGCGCC	1 cut(s)	348
Sfr274I	CTCGAG	1 cut(s)	331
SgrAI	CRCCGGYG	1 cut(s)	349
SinI	GGWCC	2 cut(s)	176, 184
SlaI	CTCGAG	1 cut(s)	331
SmiMI	CAYNNNNRTG	2 cut(s)	437, 450
SmlI	CTYRAG	2 cut(s)	264, 331
SmoI	CTYRAG	2 cut(s)	264, 331
Sse9I	AATT	1 cut(s)	378
SsiI	CCGC	6 cut(s)	138, 141, 144, 158, 272, 344
SspDI	GGCGCC	1 cut(s)	346
SspMI	CTAG	2 cut(s)	110, 547
StyD4I	CCNGG	4 cut(s)	78, 85, 98, 178
TaaI	ACNGT	2 cut(s)	358, 366
TaiI	ACGT	1 cut(s)	252
TaqI	TCGA	3 cut(s)	236, 311, 332
TasI	AATT	1 cut(s)	378
TatI	WGTACW	4 cut(s)	10, 30, 429, 435
TauI	GCSGC	6 cut(s)	140, 143, 146, 161, 275, 347
Tru1I	TTAA	2 cut(s)	192, 390
Tru9I	TTAA	2 cut(s)	192, 390
TseFI	GTSAC	1 cut(s)	352
TseI	GCWGC	2 cut(s)	155, 523
Tsp45I	GTSAC	1 cut(s)	352
TspGWI	ACGGA	1 cut(s)	329
VpaK11BI	GGWCC	2 cut(s)	176, 184
VspI	ATTAAT	1 cut(s)	390
XapI	RAATTY	1 cut(s)	378
XceI	RCATGY	3 cut(s)	436, 442, 481
XhoI	CTCGAG	1 cut(s)	331
XspI	CTAG	2 cut(s)	110, 547

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.