RLG00000025324

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
OG0008185
Physical Location & Seq
Forward (+)
44366295 .. 44366763
469 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000025324

Sequence Viewer

Length: 339 bp
ATGGCACCGCTGTCTGTCTCCATCCTAAGTGGAGACACCCGCTCCACCTCCCCCAATCCAATCTCAGCCTTCCAACGCTGGTTTTTCCTGGCGCCCACCCAACAACACGAAAGTTCTGCAACTTTCAAGGTTTCTGCTCCTTGCTGGATTGAGTTCGGTCCAGACCACGGCGGATCTCCAGGGGCTAGCCTCTTGCGCTTTTCTCCAAGCGGCAGTGGTGGCTTGCTCTTAGGAGCGAGTGGATTTCTTGATTCGGGTCTCCGTTCTGTCAAACTTTGGGATCTGCGAAAGGTGGTGAAATCGGGGGCGATATGTCTCAGGATCCGAAGTGGAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

11.78

Weight (kDa)

10.04

Isoelectric Point (pI)

65.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 4, 91
AccBSI CCGCTC 1 cut(s) 42
AciI CCGC 4 cut(s) 8, 40, 171, 210
AclWI GGATC 4 cut(s) 181, 288, 316, 329
AcyI GRCGYC 1 cut(s) 92
AfiI CCNNNNNNNGG 1 cut(s) 167
AgsI TTSAA 1 cut(s) 127
AjnI CCWGG 2 cut(s) 87, 178
Alw26I GTCTC 4 cut(s) 22, 27, 263, 320
AlwI GGATC 4 cut(s) 181, 288, 316, 329
AspLEI GCGC 2 cut(s) 94, 198
AspS9I GGNCC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 307
AsuNHI GCTAGC 1 cut(s) 185
AvaII GGWCC 1 cut(s) 158
BamHI GGATCC 1 cut(s) 321
BanI GGYRCC 2 cut(s) 4, 91
BccI CCATC 1 cut(s) 29
BceAI ACGGC 1 cut(s) 184
BcgI CGANNNNNNTGC 2 cut(s) 98, 132
BciT130I CCWGG 2 cut(s) 89, 180
BcoDI GTCTC 4 cut(s) 22, 27, 263, 320
BfaI CTAG 2 cut(s) 186, 337
BfoI RGCGCY 1 cut(s) 95
BisI GCNGC 1 cut(s) 211
BlsI GCNGC 1 cut(s) 212
Bme1390I CCNGG 2 cut(s) 89, 180
Bme18I GGWCC 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 158
BmiI GGNNCC 3 cut(s) 6, 93, 323
BmrFI CCNGG 2 cut(s) 89, 180
BmtI GCTAGC 1 cut(s) 189
BpmI CTGGAG 1 cut(s) 162
BsaHI GRCGYC 1 cut(s) 92
BsaI GGTCTC 1 cut(s) 263
BsaJI CCNNGG 2 cut(s) 166, 179
BsaXI ACNNNNNCTCC 2 cut(s) 26, 56
Bsc4I CCNNNNNNNGG 1 cut(s) 167
BseBI CCWGG 2 cut(s) 89, 180
BseDI CCNNGG 2 cut(s) 166, 179
BseGI GGATG 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 167
BseMII CTCAG 2 cut(s) 78, 331
BshNI GGYRCC 2 cut(s) 4, 91
BslI CCNNNNNNNGG 1 cut(s) 167
BsmAI GTCTC 4 cut(s) 22, 27, 263, 320
Bso31I GGTCTC 1 cut(s) 263
Bsp143I GATC 3 cut(s) 173, 280, 321
BspACI CCGC 4 cut(s) 8, 40, 171, 210
BspCNI CTCAG 2 cut(s) 77, 330
BspLI GGNNCC 3 cut(s) 6, 93, 323
BspOI GCTAGC 1 cut(s) 189
BspPI GGATC 4 cut(s) 181, 288, 316, 329
BspT107I GGYRCC 2 cut(s) 4, 91
BspTNI GGTCTC 1 cut(s) 263
BsrBI CCGCTC 1 cut(s) 42
BssECI CCNNGG 2 cut(s) 166, 179
BssMI GATC 3 cut(s) 173, 280, 321
BssNI GRCGYC 1 cut(s) 92
Bst2UI CCWGG 2 cut(s) 89, 180
BstACI GRCGYC 1 cut(s) 92
BstC8I GCNNGC 2 cut(s) 187, 224
BstDEI CTNAG 4 cut(s) 26, 64, 229, 317
BstDSI CCRYGG 1 cut(s) 166
BstF5I GGATG 1 cut(s) 21
BstH2I RGCGCY 1 cut(s) 95
BstHHI GCGC 2 cut(s) 94, 198
BstKTI GATC 3 cut(s) 176, 283, 324
BstMAI GTCTC 4 cut(s) 22, 27, 263, 320
BstMBI GATC 3 cut(s) 173, 280, 321
BstMWI GCNNNNNNNGC 2 cut(s) 195, 219
BstNI CCWGG 2 cut(s) 89, 180
BstSCI CCNGG 2 cut(s) 87, 178
BstX2I RGATCY 3 cut(s) 173, 280, 321
BstYI RGATCY 3 cut(s) 173, 280, 321
BtgI CCRYGG 1 cut(s) 166
BtsCI GGATG 1 cut(s) 21
BtsI GCAGTG 1 cut(s) 220
BtsIMutI CAGTG 1 cut(s) 220
Cac8I GCNNGC 2 cut(s) 187, 224
CfoI GCGC 2 cut(s) 94, 198
Cfr13I GGNCC 1 cut(s) 158
CviJI RGCY 5 cut(s) 68, 185, 189, 222, 336
CviKI_1 RGCY 5 cut(s) 68, 185, 189, 222, 336
DdeI CTNAG 4 cut(s) 26, 64, 229, 317
DinI GGCGCC 1 cut(s) 93
DpnI GATC 3 cut(s) 175, 282, 323
DpnII GATC 3 cut(s) 173, 280, 321
EciI GGCGGA 1 cut(s) 186
Eco31I GGTCTC 1 cut(s) 263
Eco47I GGWCC 1 cut(s) 158
EcoRII CCWGG 2 cut(s) 87, 178
EgeI GGCGCC 1 cut(s) 93
EheI GGCGCC 1 cut(s) 93
FaiI YATR 1 cut(s) 313
FauI CCCGC 1 cut(s) 47
Fnu4HI GCNGC 1 cut(s) 211
FokI GGATG 1 cut(s) 8
Fsp4HI GCNGC 1 cut(s) 211
FspBI CTAG 2 cut(s) 186, 337
GlaI GCGC 2 cut(s) 93, 197
GluI GCNGC 1 cut(s) 211
GsuI CTGGAG 1 cut(s) 162
HaeII RGCGCY 1 cut(s) 95
HhaI GCGC 2 cut(s) 94, 198
Hin1I GRCGYC 1 cut(s) 92
Hin6I GCGC 2 cut(s) 92, 196
HinP1I GCGC 2 cut(s) 92, 196
HinfI GANTC 1 cut(s) 251
HphI GGTGA 1 cut(s) 307
Hpy188I TCNGA 1 cut(s) 326
Hpy188III TCNNGA 3 cut(s) 161, 248, 319
HpyAV CCTTC 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 119
HpyF10VI GCNNNNNNNGC 2 cut(s) 195, 219
HpyF3I CTNAG 4 cut(s) 26, 64, 229, 317
Hsp92I GRCGYC 1 cut(s) 92
HspAI GCGC 2 cut(s) 92, 196
KasI GGCGCC 1 cut(s) 91
Kzo9I GATC 3 cut(s) 173, 280, 321
LmnI GCTCC 3 cut(s) 47, 142, 233
LpnPI CCDG 8 cut(s) 64, 74, 101, 130, 165, 174, 192, 304
MaeI CTAG 2 cut(s) 186, 337
MalI GATC 3 cut(s) 175, 282, 323
MbiI CCGCTC 1 cut(s) 42
MboI GATC 3 cut(s) 173, 280, 321
MflI RGATCY 3 cut(s) 173, 280, 321
Mly113I GGCGCC 1 cut(s) 92
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 3 cut(s) 58, 200, 326
MspA1I CMGCKG 1 cut(s) 10
MspR9I CCNGG 2 cut(s) 89, 180
MvaI CCWGG 2 cut(s) 89, 180
MwoI GCNNNNNNNGC 2 cut(s) 195, 219
NarI GGCGCC 1 cut(s) 92
NdeII GATC 3 cut(s) 173, 280, 321
NheI GCTAGC 1 cut(s) 185
NlaIV GGNNCC 3 cut(s) 6, 93, 323
PfeI GAWTC 1 cut(s) 251
PkrI GCNGC 1 cut(s) 212
PluTI GGCGCC 1 cut(s) 95
Psp6I CCWGG 2 cut(s) 87, 178
PspGI CCWGG 2 cut(s) 87, 178
PspN4I GGNNCC 3 cut(s) 6, 93, 323
PspPI GGNCC 1 cut(s) 158
PsuI RGATCY 3 cut(s) 173, 280, 321
SatI GCNGC 1 cut(s) 211
Sau3AI GATC 3 cut(s) 173, 280, 321
Sau96I GGNCC 1 cut(s) 158
ScrFI CCNGG 2 cut(s) 89, 180
SetI ASST 3 cut(s) 50, 132, 294
SfoI GGCGCC 1 cut(s) 93
SinI GGWCC 1 cut(s) 158
SsiI CCGC 4 cut(s) 8, 40, 171, 210
SspDI GGCGCC 1 cut(s) 91
SspMI CTAG 2 cut(s) 186, 337
StyD4I CCNGG 2 cut(s) 87, 178
TaqII GACCGA 1 cut(s) 146
TauI GCSGC 1 cut(s) 213
TfiI GAWTC 1 cut(s) 251
TscAI CASTG 1 cut(s) 220
TspGWI ACGGA 1 cut(s) 251
TspRI CASTG 1 cut(s) 220
VpaK11BI GGWCC 1 cut(s) 158
XspI CTAG 2 cut(s) 186, 337
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.