Rh6AG473200

Plant lipoxygenase may be involved in a number of diverse aspects of plant physiology including growth and development, pest resistance, and senescence or responses to wounding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0008185
Physical Location & Seq
Forward (+)
65521602 .. 65521893
292 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG473200.1

Sequence Viewer

Length: 162 bp
ATGCTGGCTGGAGTCAACCCTGTAACCATTCGTCGCCTCCAAACGTTTCCACCAGCAAGCAAACTAGATCCAAATGTTTATGGTGATCACAGCAGTACCATAACCGAACACCACATCAAGAATAACTTGGATGGGCTAACGGTGCATCAGGTCTCCGATTAA

Protein Analysis

53

Amino Acids

5.84

Weight (kDa)

6.38

Isoelectric Point (pI)

47.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Lipoxygenase PF00305 1 - 50 6.7e-17 Lipoxygenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 44
AclWI GGATC 1 cut(s) 62
AfaI GTAC 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 157
AlwI GGATC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 95
BaeI ACNNNNGTAYC 2 cut(s) 79, 112
BccI CCATC 1 cut(s) 125
BclI TGATCA 1 cut(s) 85
BcoDI GTCTC 1 cut(s) 157
BfaI CTAG 1 cut(s) 65
BmsI GCATC 1 cut(s) 154
BpmI CTGGAG 1 cut(s) 30
BsaI GGTCTC 1 cut(s) 157
BseGI GGATG 1 cut(s) 136
BsmAI GTCTC 1 cut(s) 157
Bso31I GGTCTC 1 cut(s) 157
Bsp143I GATC 2 cut(s) 67, 85
BspPI GGATC 1 cut(s) 62
BspTNI GGTCTC 1 cut(s) 157
BssMI GATC 2 cut(s) 67, 85
Bst4CI ACNGT 1 cut(s) 142
BstC8I GCNNGC 2 cut(s) 6, 58
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 2 cut(s) 70, 88
BstMAI GTCTC 1 cut(s) 157
BstMBI GATC 2 cut(s) 67, 85
BstMWI GCNNNNNNNGC 1 cut(s) 142
BstX2I RGATCY 1 cut(s) 67
BstYI RGATCY 1 cut(s) 67
BtsCI GGATG 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 6, 58
Csp6I GTAC 1 cut(s) 96
CviJI RGCY 2 cut(s) 8, 136
CviKI_1 RGCY 2 cut(s) 8, 136
CviQI GTAC 1 cut(s) 96
DpnI GATC 2 cut(s) 69, 87
DpnII GATC 2 cut(s) 67, 85
Eco31I GGTCTC 1 cut(s) 157
FaiI YATR 2 cut(s) 81, 101
FalI AAGNNNNNCTT 2 cut(s) 110, 142
FbaI TGATCA 1 cut(s) 85
FokI GGATG 1 cut(s) 143
FspBI CTAG 1 cut(s) 65
GsuI CTGGAG 1 cut(s) 30
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
HinfI GANTC 1 cut(s) 12
HphI GGTGA 1 cut(s) 95
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 118
Hpy8I GTNNAC 1 cut(s) 16
Hpy99I CGWCG 1 cut(s) 36
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4IV ACGT 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 145
HpyF10VI GCNNNNNNNGC 1 cut(s) 142
HpySE526I ACGT 1 cut(s) 44
Ksp22I TGATCA 1 cut(s) 85
Kzo9I GATC 2 cut(s) 67, 85
LpnPI CCDG 3 cut(s) 33, 66, 134
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 65
MaeII ACGT 1 cut(s) 44
MaeIII GTNAC 1 cut(s) 22
MalI GATC 2 cut(s) 69, 87
MboI GATC 2 cut(s) 67, 85
MflI RGATCY 1 cut(s) 67
MlyI GAGTC 1 cut(s) 21
MnlI CCTC 1 cut(s) 47
MseI TTAA 1 cut(s) 160
MwoI GCNNNNNNNGC 1 cut(s) 142
NdeII GATC 2 cut(s) 67, 85
PleI GAGTC 1 cut(s) 20
PpsI GAGTC 1 cut(s) 20
Psp1406I AACGTT 1 cut(s) 44
PsuI RGATCY 1 cut(s) 67
RsaI GTAC 1 cut(s) 97
RsaNI GTAC 1 cut(s) 96
SaqAI TTAA 1 cut(s) 160
Sau3AI GATC 2 cut(s) 67, 85
SchI GAGTC 1 cut(s) 21
SetI ASST 2 cut(s) 47, 153
SfaNI GCATC 1 cut(s) 154
SgeI CNNG 8 cut(s) 17, 21, 32, 65, 69, 77, 130, 139
SspMI CTAG 1 cut(s) 65
TaaI ACNGT 1 cut(s) 142
TaiI ACGT 1 cut(s) 47
Tru1I TTAA 1 cut(s) 160
Tru9I TTAA 1 cut(s) 160
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.