Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005706.1

Orthogroup ID

OG0008185

Physical Location & Seq

Genomic Coordinates Forward (+)

24813 .. 28299

Gene Structure 3487 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005706.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 765 bp

atggggattctgtggattgattcaaccaacttgcggacgcttaaatatttcatgatgttggttgacacgcaaacacgctggatcactcctcggatcatcctattcagtcaattggatttgactgtgctagagaatttacatcgaaagactttcgatggatattgcaatgagactgatgttggacatcatattcccatgtacacacctaaatggtcttgtggaaacgactacgatggtagtccggacattggaacgataggaattgtcgtggcttgttccccactatgtctcatctcgttccctgttaaagtgacgagatcacacaaatatgccgcaaacaagcctgcatggaaggacgtccctacgagaggacgtagcgccaccgtacacggaggtaggcacgacaccaaagccaaagagagtggcactctaatgttacagaccatggccccagctaggatgcatgggattcccgtgggttcgaaggatgctttagcacactccaatcctttgatcatcaacactcaaaatccatctaatgagaatcttccgggttatggcgatagggttgcttggaggactgatgaagaatttgccagagaaatgctaactggagtcaaccctgtaaccatttgtcgcctccaaacgtttccaccagcaagcaaactagatccaaatgtttatggtgatcacagtagtaccataacagaacaccacatcaagaataacttggatgggctaacggtgcatcaggtctccgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0008150 GO:0008152 GO:0016165 GO:0016491 GO:0016701 GO:0016702 GO:0044424 GO:0044464 GO:0051213 GO:0055114

KEGG Pathways

Metabolic & Signaling

ko00591 ko00592 ko01100 ko01110 map00591 map00592 map01100 map01110

Pfam Domains

Protein Families

Lipoxygenase PLAT

Protein Analysis

254

Amino Acids

28.3

Weight (kDa)

7.2

Isoelectric Point (pI)

42.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008185)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000016386 RLG00000019388 RLG00000023749 RLG00000025324 RLG00000029183 RLG00000029321
rosa_multiflora	Rmu_sc0000674.1_g000016 Rmu_sc0005706.1_g000007 Rmu_ssc0000421.1_g000059
rosa_roxburghii	Rroxscaffold_158G00443760 Rroxscaffold_4G00310830
rosa_rugosa	Rorug01G0064200 Rorug04G0428800
rosa_samantha	Rh1CG371300 Rh1DG388700 Rh2AG237800 Rh2DG245300 Rh4CG156000 Rh4DG117200 Rh6AG473200 Rh6BG089600 Rh6BG320100 Rh6DG336000 Rh7DG021200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	360
AccIII	TCCGGA	1 cut(s)	241
AciI	CCGC	2 cut(s)	34, 333
AclI	AACGTT	1 cut(s)	647
AclWI	GGATC	3 cut(s)	89, 101, 665
AcsI	RAATTY	2 cut(s)	133, 590
AcyI	GRCGYC	1 cut(s)	357
AfaI	GTAC	3 cut(s)	200, 387, 700
AfiI	CCNNNNNNNGG	5 cut(s)	33, 248, 368, 456, 557
AgsI	TTSAA	1 cut(s)	24
AluBI	AGCT	1 cut(s)	455
AluI	AGCT	1 cut(s)	455
Alw26I	GTCTC	3 cut(s)	164, 293, 760
AlwI	GGATC	3 cut(s)	89, 101, 665
Aor13HI	TCCGGA	1 cut(s)	241
AoxI	GGCC	1 cut(s)	447
ApoI	RAATTY	2 cut(s)	133, 590
AspLEI	GCGC	1 cut(s)	380
AspS9I	GGNCC	1 cut(s)	448
AsuC2I	CCSGG	1 cut(s)	552
AsuHPI	GGTGA	1 cut(s)	698
AsuII	TTCGAA	1 cut(s)	482
BaeI	ACNNNNGTAYC	2 cut(s)	682, 715
BccI	CCATC	4 cut(s)	149, 227, 541, 728
BcgI	CGANNNNNNTGC	2 cut(s)	551, 585
BclI	TGATCA	2 cut(s)	513, 688
BcnI	CCSGG	1 cut(s)	552
BcoDI	GTCTC	3 cut(s)	164, 293, 760
BfaI	CTAG	3 cut(s)	128, 456, 668
BfoI	RGCGCY	1 cut(s)	381
BisI	GCNGC	1 cut(s)	333
BlsI	GCNGC	1 cut(s)	334
Bme1390I	CCNGG	1 cut(s)	552
BmgT120I	GGNCC	1 cut(s)	448
BmiI	GGNNCC	1 cut(s)	450
BmrFI	CCNGG	1 cut(s)	552
BmsI	GCATC	3 cut(s)	450, 478, 757
BplI	GAGNNNNNCTC	2 cut(s)	412, 444
BpmI	CTGGAG	1 cut(s)	633
Bpu14I	TTCGAA	1 cut(s)	482
BpuMI	CCSGG	1 cut(s)	552
BsaHI	GRCGYC	1 cut(s)	357
BsaI	GGTCTC	1 cut(s)	760
BsaJI	CCNNGG	3 cut(s)	89, 444, 474
BsaWI	WCCGGW	1 cut(s)	241
Bsc4I	CCNNNNNNNGG	5 cut(s)	33, 248, 368, 456, 557
Bse1I	ACTGG	1 cut(s)	616
Bse3DI	GCAATG	1 cut(s)	172
BseAI	TCCGGA	1 cut(s)	241
BseDI	CCNNGG	3 cut(s)	89, 444, 474
BseGI	GGATG	4 cut(s)	96, 465, 493, 739
BseLI	CCNNNNNNNGG	5 cut(s)	33, 248, 368, 456, 557
BseMI	GCAATG	1 cut(s)	172
BseNI	ACTGG	1 cut(s)	616
BseRI	GAGGAG	1 cut(s)	78
BseYI	CCCAGC	1 cut(s)	451
BshFI	GGCC	1 cut(s)	449
BsiSI	CCGG	2 cut(s)	242, 551
BslFI	GGGAC	1 cut(s)	344
BslI	CCNNNNNNNGG	5 cut(s)	33, 248, 368, 456, 557
BsmAI	GTCTC	3 cut(s)	164, 293, 760
BsmFI	GGGAC	1 cut(s)	344
BsnI	GGCC	1 cut(s)	449
Bso31I	GGTCTC	1 cut(s)	760
Bsp119I	TTCGAA	1 cut(s)	482
Bsp13I	TCCGGA	1 cut(s)	241
Bsp1407I	TGTACA	1 cut(s)	198
Bsp143I	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
Bsp19I	CCATGG	1 cut(s)	444
BspACI	CCGC	2 cut(s)	34, 333
BspANI	GGCC	1 cut(s)	449
BspEI	TCCGGA	1 cut(s)	241
BspHI	TCATGA	1 cut(s)	51
BspLI	GGNNCC	1 cut(s)	450
BspPI	GGATC	3 cut(s)	89, 101, 665
BspT104I	TTCGAA	1 cut(s)	482
BspTNI	GGTCTC	1 cut(s)	760
BsrDI	GCAATG	1 cut(s)	172
BsrGI	TGTACA	1 cut(s)	198
BsrI	ACTGG	1 cut(s)	616
BssECI	CCNNGG	3 cut(s)	89, 444, 474
BssMI	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
BssNI	GRCGYC	1 cut(s)	357
BssT1I	CCWWGG	1 cut(s)	444
Bst4CI	ACNGT	4 cut(s)	124, 385, 695, 745
BstACI	GRCGYC	1 cut(s)	357
BstAUI	TGTACA	1 cut(s)	198
BstBI	TTCGAA	1 cut(s)	482
BstC8I	GCNNGC	2 cut(s)	345, 661
BstDSI	CCRYGG	2 cut(s)	444, 474
BstENI	CCTNNNNNAGG	1 cut(s)	366
BstF5I	GGATG	4 cut(s)	96, 465, 493, 739
BstH2I	RGCGCY	1 cut(s)	381
BstHHI	GCGC	1 cut(s)	380
BstKTI	GATC	6 cut(s)	84, 96, 320, 516, 673, 691
BstMAI	GTCTC	3 cut(s)	164, 293, 760
BstMBI	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
BstMWI	GCNNNNNNNGC	1 cut(s)	745
BstSCI	CCNGG	1 cut(s)	550
BstX2I	RGATCY	1 cut(s)	670
BstYI	RGATCY	1 cut(s)	670
BsuRI	GGCC	1 cut(s)	449
BtgI	CCRYGG	2 cut(s)	444, 474
BtsCI	GGATG	4 cut(s)	96, 465, 493, 739
Cac8I	GCNNGC	2 cut(s)	345, 661
CciI	TCATGA	1 cut(s)	51
CfoI	GCGC	1 cut(s)	380
Cfr13I	GGNCC	1 cut(s)	448
CseI	GACGC	1 cut(s)	46
Csp6I	GTAC	3 cut(s)	199, 386, 699
CspCI	CAANNNNNGTGG	2 cut(s)	403, 438
CviAII	CATG	5 cut(s)	52, 196, 348, 445, 464
CviJI	RGCY	6 cut(s)	272, 343, 413, 449, 455, 739
CviKI_1	RGCY	6 cut(s)	272, 343, 413, 449, 455, 739
CviQI	GTAC	3 cut(s)	199, 386, 699
DpnI	GATC	6 cut(s)	83, 95, 319, 515, 672, 690
DpnII	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
Eco130I	CCWWGG	1 cut(s)	444
Eco31I	GGTCTC	1 cut(s)	760
EcoNI	CCTNNNNNAGG	1 cut(s)	366
EcoT14I	CCWWGG	1 cut(s)	444
EcoT22I	ATGCAT	1 cut(s)	465
ErhI	CCWWGG	1 cut(s)	444
FaeI	CATG	5 cut(s)	55, 199, 351, 448, 467
FalI	AAGNNNNNCTT	2 cut(s)	713, 745
FaqI	GGGAC	1 cut(s)	344
FatI	CATG	5 cut(s)	51, 195, 347, 444, 463
FbaI	TGATCA	2 cut(s)	513, 688
Fnu4HI	GCNGC	1 cut(s)	333
FokI	GGATG	4 cut(s)	83, 472, 500, 746
Fsp4HI	GCNGC	1 cut(s)	333
FspBI	CTAG	3 cut(s)	128, 456, 668
GlaI	GCGC	1 cut(s)	379
GluI	GCNGC	1 cut(s)	333
GsaI	CCCAGC	1 cut(s)	455
GsuI	CTGGAG	1 cut(s)	633
HaeII	RGCGCY	1 cut(s)	381
HaeIII	GGCC	1 cut(s)	449
HapII	CCGG	2 cut(s)	242, 551
HgaI	GACGC	1 cut(s)	46
HhaI	GCGC	1 cut(s)	380
Hin1I	GRCGYC	1 cut(s)	357
Hin1II	CATG	5 cut(s)	55, 199, 351, 448, 467
Hin6I	GCGC	1 cut(s)	378
HinP1I	GCGC	1 cut(s)	378
HincII	GTYRAC	2 cut(s)	64, 619
HindII	GTYRAC	2 cut(s)	64, 619
HinfI	GANTC	5 cut(s)	7, 20, 469, 544, 615
HpaII	CCGG	2 cut(s)	242, 551
HphI	GGTGA	1 cut(s)	698
Hpy166II	GTNNAC	4 cut(s)	64, 201, 388, 619
Hpy188I	TCNGA	2 cut(s)	93, 760
Hpy188III	TCNNGA	3 cut(s)	52, 242, 721
Hpy8I	GTNNAC	4 cut(s)	64, 201, 388, 619
HpyAV	CCTTC	2 cut(s)	346, 478
HpyCH4III	ACNGT	4 cut(s)	124, 385, 695, 745
HpyCH4IV	ACGT	3 cut(s)	357, 373, 647
HpyCH4V	TGCA	4 cut(s)	165, 347, 463, 748
HpyF10VI	GCNNNNNNNGC	1 cut(s)	745
HpySE526I	ACGT	3 cut(s)	357, 373, 647
Hsp92I	GRCGYC	1 cut(s)	357
Hsp92II	CATG	5 cut(s)	55, 199, 351, 448, 467
HspAI	GCGC	1 cut(s)	378
Kpn2I	TCCGGA	1 cut(s)	241
Ksp22I	TGATCA	2 cut(s)	513, 688
Kzo9I	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
LweI	GCATC	3 cut(s)	450, 478, 757
MaeI	CTAG	3 cut(s)	128, 456, 668
MaeII	ACGT	3 cut(s)	357, 373, 647
MaeIII	GTNAC	3 cut(s)	310, 435, 625
MalI	GATC	6 cut(s)	83, 95, 319, 515, 672, 690
MboI	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
MboII	GAAGA	2 cut(s)	539, 599
MfeI	CAATTG	1 cut(s)	110
MflI	RGATCY	1 cut(s)	670
MluCI	AATT	4 cut(s)	110, 133, 261, 590
MlyI	GAGTC	1 cut(s)	624
MmeI	TCCRAC	1 cut(s)	160
MnlI	CCTC	5 cut(s)	99, 362, 386, 570, 650
Mph1103I	ATGCAT	1 cut(s)	465
MroI	TCCGGA	1 cut(s)	241
MseI	TTAA	3 cut(s)	42, 306, 763
MslI	CAYNNNNRTG	3 cut(s)	208, 327, 431
MspI	CCGG	2 cut(s)	242, 551
MspR9I	CCNGG	1 cut(s)	552
MunI	CAATTG	1 cut(s)	110
MwoI	GCNNNNNNNGC	1 cut(s)	745
NciI	CCSGG	1 cut(s)	552
NcoI	CCATGG	1 cut(s)	444
NdeII	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
NlaIII	CATG	5 cut(s)	55, 199, 351, 448, 467
NlaIV	GGNNCC	1 cut(s)	450
NmuCI	GTSAC	1 cut(s)	310
NsiI	ATGCAT	1 cut(s)	465
NspV	TTCGAA	1 cut(s)	482
PagI	TCATGA	1 cut(s)	51
PfeI	GAWTC	4 cut(s)	7, 20, 469, 544
PkrI	GCNGC	1 cut(s)	334
PleI	GAGTC	1 cut(s)	623
PpsI	GAGTC	1 cut(s)	623
Psp1406I	AACGTT	1 cut(s)	647
PspFI	CCCAGC	1 cut(s)	451
PspN4I	GGNNCC	1 cut(s)	450
PspPI	GGNCC	1 cut(s)	448
PsuI	RGATCY	1 cut(s)	670
RsaI	GTAC	3 cut(s)	200, 387, 700
RsaNI	GTAC	3 cut(s)	199, 386, 699
RseI	CAYNNNNRTG	3 cut(s)	208, 327, 431
SaqAI	TTAA	3 cut(s)	42, 306, 763
SatI	GCNGC	1 cut(s)	333
Sau3AI	GATC	6 cut(s)	81, 93, 317, 513, 670, 688
Sau96I	GGNCC	1 cut(s)	448
SchI	GAGTC	1 cut(s)	624
ScrFI	CCNGG	1 cut(s)	552
SetI	ASST	7 cut(s)	208, 360, 376, 397, 457, 650, 756
SfaNI	GCATC	3 cut(s)	450, 478, 757
SfuI	TTCGAA	1 cut(s)	482
SmiMI	CAYNNNNRTG	3 cut(s)	208, 327, 431
Sse9I	AATT	4 cut(s)	110, 133, 261, 590
SsiI	CCGC	2 cut(s)	34, 333
SspI	AATATT	1 cut(s)	47
SspMI	CTAG	3 cut(s)	128, 456, 668
StyD4I	CCNGG	1 cut(s)	550
StyI	CCWWGG	1 cut(s)	444
TaaI	ACNGT	4 cut(s)	124, 385, 695, 745
TaiI	ACGT	3 cut(s)	360, 376, 650
TaqI	TCGA	3 cut(s)	142, 153, 482
TasI	AATT	4 cut(s)	110, 133, 261, 590
TatI	WGTACW	1 cut(s)	198
TauI	GCSGC	1 cut(s)	335
TfiI	GAWTC	4 cut(s)	7, 20, 469, 544
Tru1I	TTAA	3 cut(s)	42, 306, 763
Tru9I	TTAA	3 cut(s)	42, 306, 763
TseFI	GTSAC	1 cut(s)	310
Tsp45I	GTSAC	1 cut(s)	310
TspDTI	ATGAA	2 cut(s)	40, 600
TspGWI	ACGGA	1 cut(s)	405
XagI	CCTNNNNNAGG	1 cut(s)	366
XapI	RAATTY	2 cut(s)	133, 590
XspI	CTAG	3 cut(s)	128, 456, 668
ZraI	GACGTC	1 cut(s)	358
Zsp2I	ATGCAT	1 cut(s)	465

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.