Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8019532.1

Orthogroup ID

OG0006386

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 435

Gene Structure 435 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8019532.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

atgttccggttctgcatagccgacacagaacatgattggagagaaggaacagagcagtacaagttcattgagaactgctttgcaacagttgatagacaaaagcaaccatggctgatatttcttgcacatcgggtattgggttactcttctgcgagcttttatgtagctgaaggatcgtttgaggaaccaatgggaagggagagccttcagaaactatggcagaaatacaaggttgacattgctgtatatggccatgtgcacaattatgaaaggacatgtcccatttacgag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Metallophos Metallophos_C Pur_ac_phosph_N

Protein Analysis

97

Amino Acids

11.64

Weight (kDa)

5.78

Isoelectric Point (pI)

34.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006386)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g14914 FvH4_3g26380
prunus_persica	Prupe.6G199600_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0117641 RchiOBHm_Chr6g0270561
rosa_laevigata	RLG00000019052 RLG00000019366 RLG00000019367
rosa_multiflora	Rmu_co8019532.1_g000001 Rmu_co8259759.1_g000001
rosa_roxburghii	Rroxscaffold_1G00033320 Rroxscaffold_2G00126300 Rroxscaffold_3G00218160 Rroxscaffold_4G00329500 Rroxscaffold_5G00359250
rosa_samantha	Rh2CG154500 Rh3AG203600 Rh3BG233400 Rh4DG365700 Rh5BG458000 Rh5CG479800 Rh6BG177900 Rh6BG223700 Rh6DG009700 Rh6DG216700 Rh7AG108700 Rh7AG109000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	181
AcoI	YGGCCR	1 cut(s)	250
AcuI	CTGAAG	2 cut(s)	189, 191
AfaI	GTAC	1 cut(s)	59
AflIII	ACRYGT	1 cut(s)	275
AluBI	AGCT	2 cut(s)	156, 167
AluI	AGCT	2 cut(s)	156, 167
Alw21I	GWGCWC	1 cut(s)	261
Alw44I	GTGCAC	1 cut(s)	257
AlwI	GGATC	1 cut(s)	181
AoxI	GGCC	1 cut(s)	250
ApaLI	GTGCAC	1 cut(s)	257
BaeGI	GKGCMC	1 cut(s)	261
BalI	TGGCCA	1 cut(s)	252
Bbv12I	GWGCWC	1 cut(s)	261
BmiI	GGNNCC	1 cut(s)	186
BsaJI	CCNNGG	1 cut(s)	107
BsaWI	WCCGGW	1 cut(s)	6
Bse3DI	GCAATG	1 cut(s)	237
BseDI	CCNNGG	1 cut(s)	107
BseMI	GCAATG	1 cut(s)	237
BseSI	GKGCMC	1 cut(s)	261
BshFI	GGCC	1 cut(s)	252
BsiHKAI	GWGCWC	1 cut(s)	261
BsiSI	CCGG	1 cut(s)	7
BslFI	GGGAC	1 cut(s)	264
BsmFI	GGGAC	1 cut(s)	264
BsnI	GGCC	1 cut(s)	252
Bsp1286I	GDGCHC	1 cut(s)	261
Bsp143I	GATC	1 cut(s)	173
Bsp19I	CCATGG	1 cut(s)	107
BspANI	GGCC	1 cut(s)	252
BspLI	GGNNCC	1 cut(s)	186
BspPI	GGATC	1 cut(s)	181
BsrDI	GCAATG	1 cut(s)	237
BssECI	CCNNGG	1 cut(s)	107
BssMI	GATC	1 cut(s)	173
BssT1I	CCWWGG	1 cut(s)	107
Bst4CI	ACNGT	1 cut(s)	88
Bst6I	CTCTTC	1 cut(s)	151
BstC8I	GCNNGC	1 cut(s)	154
BstDSI	CCRYGG	1 cut(s)	107
BstKTI	GATC	1 cut(s)	176
BstMBI	GATC	1 cut(s)	173
BstMWI	GCNNNNNNNGC	1 cut(s)	109
BstNSI	RCATGY	1 cut(s)	279
BstSLI	GKGCMC	1 cut(s)	261
BsuRI	GGCC	1 cut(s)	252
BtgI	CCRYGG	1 cut(s)	107
Cac8I	GCNNGC	1 cut(s)	154
Csp6I	GTAC	1 cut(s)	58
CviAII	CATG	4 cut(s)	32, 108, 254, 276
CviJI	RGCY	6 cut(s)	20, 112, 156, 167, 204, 252
CviKI_1	RGCY	6 cut(s)	20, 112, 156, 167, 204, 252
CviQI	GTAC	1 cut(s)	58
DpnI	GATC	1 cut(s)	175
DpnII	GATC	1 cut(s)	173
EaeI	YGGCCR	1 cut(s)	250
Eam1104I	CTCTTC	1 cut(s)	151
EarI	CTCTTC	1 cut(s)	151
Eco130I	CCWWGG	1 cut(s)	107
Eco57I	CTGAAG	2 cut(s)	189, 191
EcoT14I	CCWWGG	1 cut(s)	107
ErhI	CCWWGG	1 cut(s)	107
FaeI	CATG	4 cut(s)	35, 111, 257, 279
FaqI	GGGAC	1 cut(s)	264
FatI	CATG	4 cut(s)	31, 107, 253, 275
HaeIII	GGCC	1 cut(s)	252
HapII	CCGG	1 cut(s)	7
Hin1II	CATG	4 cut(s)	35, 111, 257, 279
HincII	GTYRAC	1 cut(s)	235
HindII	GTYRAC	1 cut(s)	235
HpaII	CCGG	1 cut(s)	7
Hpy166II	GTNNAC	2 cut(s)	235, 259
Hpy188I	TCNGA	1 cut(s)	210
Hpy8I	GTNNAC	2 cut(s)	235, 259
HpyAV	CCTTC	4 cut(s)	38, 164, 189, 215
HpyCH4III	ACNGT	1 cut(s)	88
HpyCH4V	TGCA	4 cut(s)	15, 83, 125, 259
HpyF10VI	GCNNNNNNNGC	1 cut(s)	109
Hsp92II	CATG	4 cut(s)	35, 111, 257, 279
Kzo9I	GATC	1 cut(s)	173
LpnPI	CCDG	1 cut(s)	20
MaeIII	GTNAC	1 cut(s)	140
MalI	GATC	1 cut(s)	175
MboI	GATC	1 cut(s)	173
MboII	GAAGA	1 cut(s)	138
MhlI	GDGCHC	1 cut(s)	261
MlsI	TGGCCA	1 cut(s)	252
MluCI	AATT	1 cut(s)	262
MluNI	TGGCCA	1 cut(s)	252
MnlI	CCTC	1 cut(s)	175
Mox20I	TGGCCA	1 cut(s)	252
MscI	TGGCCA	1 cut(s)	252
MslI	CAYNNNNRTG	1 cut(s)	264
Msp20I	TGGCCA	1 cut(s)	252
MspI	CCGG	1 cut(s)	7
MwoI	GCNNNNNNNGC	1 cut(s)	109
NcoI	CCATGG	1 cut(s)	107
NdeII	GATC	1 cut(s)	173
NlaIII	CATG	4 cut(s)	35, 111, 257, 279
NlaIV	GGNNCC	1 cut(s)	186
NspI	RCATGY	1 cut(s)	279
PciI	ACATGT	1 cut(s)	275
PscI	ACATGT	1 cut(s)	275
PspN4I	GGNNCC	1 cut(s)	186
RsaI	GTAC	1 cut(s)	59
RsaNI	GTAC	1 cut(s)	58
RseI	CAYNNNNRTG	1 cut(s)	264
Sau3AI	GATC	1 cut(s)	173
SduI	GDGCHC	1 cut(s)	261
SetI	ASST	3 cut(s)	158, 169, 234
SgeI	CNNG	9 cut(s)	19, 44, 73, 120, 134, 143, 165, 241, 266
SmiMI	CAYNNNNRTG	1 cut(s)	264
Sse9I	AATT	1 cut(s)	262
StyI	CCWWGG	1 cut(s)	107
TaaI	ACNGT	1 cut(s)	88
TasI	AATT	1 cut(s)	262
TatI	WGTACW	1 cut(s)	57
TspDTI	ATGAA	2 cut(s)	55, 282
VneI	GTGCAC	1 cut(s)	257
XceI	RCATGY	1 cut(s)	279

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.