Rroxscaffold_5G00359250

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
39328276 .. 39330048
1773 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00359250.1

Sequence Viewer

Length: 156 bp
ATGGGCTTATACACAAGTTCTTGGAGTGGATTTGGAAAAGGTGGTAGAAATGGCAATGACATCATCTGCCTCAAGCTTGCTGTGTTTCAAAATAGCAGTAAGCAGAGCCGCTTTTTGACAGGGTATGTGGTCTTAATTTCTTTTCAACTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.56

Weight (kDa)

9.86

Isoelectric Point (pI)

26.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 109
AgsI TTSAA 2 cut(s) 89, 146
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
BisI GCNGC 1 cut(s) 109
BlsI GCNGC 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 56
Bse3DI GCAATG 1 cut(s) 61
BseMI GCAATG 1 cut(s) 61
BspACI CCGC 1 cut(s) 109
BsrDI GCAATG 1 cut(s) 61
BstC8I GCNNGC 1 cut(s) 78
Cac8I GCNNGC 1 cut(s) 78
CviJI RGCY 3 cut(s) 6, 76, 108
CviKI_1 RGCY 3 cut(s) 6, 76, 108
FaiI YATR 2 cut(s) 10, 126
Fnu4HI GCNGC 1 cut(s) 109
Fsp4HI GCNGC 1 cut(s) 109
GluI GCNGC 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 74
LpnPI CCDG 1 cut(s) 105
MluCI AATT 1 cut(s) 135
MnlI CCTC 1 cut(s) 80
MseI TTAA 1 cut(s) 134
PkrI GCNGC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 134
SatI GCNGC 1 cut(s) 109
SetI ASST 2 cut(s) 43, 78
SgeI CNNG 5 cut(s) 27, 33, 85, 89, 132
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
Sse9I AATT 1 cut(s) 135
SsiI CCGC 1 cut(s) 109
TasI AATT 1 cut(s) 135
TauI GCSGC 1 cut(s) 111
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.