Rroxscaffold_3G00218160

Purple acid phosphatase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
194931 .. 198571
3641 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00218160.1

Sequence Viewer

Length: 177 bp
ATGGATTCAAGTGGAGAATGTGGTGTGCTTGCTGAGACCATGTTTTACATTCCAGCAAAAACTGAGCTAACGATTGCTGACACAGAACATGACTGGAGAGAGAGAACAGACCAGTACAAGTTCTTTGAGAATTGCCTTGCATTCGGGGATAGACAAAAGGTGCAAATTTTACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

58

Amino Acids

6.79

Weight (kDa)

4.71

Isoelectric Point (pI)

37.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 165
AfaI GTAC 1 cut(s) 116
AgsI TTSAA 1 cut(s) 9
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
Alw26I GTCTC 1 cut(s) 29
ApoI RAATTY 1 cut(s) 165
BcoDI GTCTC 1 cut(s) 29
BpmI CTGGAG 1 cut(s) 115
BsaI GGTCTC 1 cut(s) 29
Bse1I ACTGG 2 cut(s) 98, 112
BseMII CTCAG 2 cut(s) 24, 54
BseNI ACTGG 2 cut(s) 98, 112
BsmAI GTCTC 1 cut(s) 29
BsmI GAATGC 1 cut(s) 140
Bso31I GGTCTC 1 cut(s) 29
BspCNI CTCAG 2 cut(s) 25, 55
BspTNI GGTCTC 1 cut(s) 29
BsrI ACTGG 2 cut(s) 98, 112
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 2 cut(s) 33, 63
BstMAI GTCTC 1 cut(s) 29
Cac8I GCNNGC 1 cut(s) 30
Csp6I GTAC 1 cut(s) 115
CviAII CATG 2 cut(s) 40, 89
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
CviQI GTAC 1 cut(s) 115
DdeI CTNAG 2 cut(s) 33, 63
Eco31I GGTCTC 1 cut(s) 29
FaeI CATG 2 cut(s) 43, 92
FaiI YATR 2 cut(s) 41, 90
FatI CATG 2 cut(s) 39, 88
GsuI CTGGAG 1 cut(s) 115
Hin1II CATG 2 cut(s) 43, 92
HinfI GANTC 1 cut(s) 5
HpyCH4V TGCA 2 cut(s) 140, 163
HpyF3I CTNAG 2 cut(s) 33, 63
Hsp92II CATG 2 cut(s) 43, 92
LpnPI CCDG 3 cut(s) 66, 79, 125
MluCI AATT 2 cut(s) 130, 165
Mva1269I GAATGC 1 cut(s) 140
NlaIII CATG 2 cut(s) 43, 92
PctI GAATGC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 5
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
SetI ASST 2 cut(s) 69, 162
Sse9I AATT 2 cut(s) 130, 165
TasI AATT 2 cut(s) 130, 165
TatI WGTACW 1 cut(s) 114
TfiI GAWTC 1 cut(s) 5
XapI RAATTY 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.