Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8021382.1

Orthogroup ID

OG0001873

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 339

Gene Structure 339 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8021382.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 177 bp

atggggcttcctgaagcatctcgaggtgtgggatcaagtaaaactgatttactaggttgttgcaagcactggaatgaatctgagtgccgagttgcaactcttgagtttgatcgtgataggaaatctatgggtgtcattgccacctcccgttcggggaaaaattctttgctagtgaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005215 GO:0005388 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005783 GO:0005789 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006816 GO:0008150 GO:0008324 GO:0010035 GO:0010038 GO:0010042 GO:0012505 GO:0015075 GO:0015085 GO:0015318 GO:0015399 GO:0015405 GO:0015662 GO:0016020 GO:0016021 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019829 GO:0022804 GO:0022853 GO:0022857 GO:0022890 GO:0030001 GO:0030176 GO:0031090 GO:0031224 GO:0031227 GO:0031984 GO:0034220 GO:0042175 GO:0042221 GO:0042623 GO:0042625 GO:0042626 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0046686 GO:0046873 GO:0050896 GO:0051179 GO:0051234 GO:0055085 GO:0070588 GO:0070838 GO:0071944 GO:0072511 GO:0090662 GO:0098588 GO:0098655 GO:0098660 GO:0098662 GO:0098805 GO:0098827 GO:0099131 GO:0099132

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_ATPase Cation_ATPase_C Cation_ATPase_N E1-E2_ATPase Hydrolase Hydrolase_3

Protein Analysis

59

Amino Acids

6.41

Weight (kDa)

9.02

Isoelectric Point (pI)

43.59

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001873)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G07670 AT1G07670 AT1G07810
fragaria_vesca	FvH4_3g34570 FvH4_3g34570 FvH4_6g14760 FvH4_6g14760 FvH4_6g14760 FvH4_6g14760
malus_domestica	MD04G1038900.v1.1 MD04G1116400.v1.1 MD11G1117700.v1.1 MD12G1132100.v1.1 MD13G1142700.v1.1
prunus_persica	Prupe.6G246300_v2.0.a1 Prupe.6G246300_v2.0.a1 Prupe.6G246300_v2.0.a1
pyrus_communis	pycom03g12390 pycom03g12400 pycom04g10640 pycom07g10780 pycom11g09870 pycom12g12810 pycom16g18850
rosa_chinensis	RchiOBHm_Chr3g0467981 RchiOBHm_Chr5g0062231
rosa_laevigata	RLG00000024462 RLG00000035545
rosa_multiflora	Rmu_co8021382.1_g000001 Rmu_sc0001793.1_g000060 Rmu_ssc0000409.1_g000035
rosa_roxburghii	Rroxscaffold_1G00018460 Rroxscaffold_6G00413240
rosa_rugosa	Rorug03G0090700 Rorug03G0090800 Rorug05G0347300
rosa_samantha	Rh3AG139600 Rh3BG161100 Rh3CG161000 Rh3DG161500 Rh5AG407900 Rh5BG421600 Rh5CG445600 Rh5DG436600
rosa_wichuraiana	Rw3G013200 Rw5G038440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	40
AcsI	RAATTY	1 cut(s)	160
AcuI	CTGAAG	1 cut(s)	33
AfiI	CCNNNNNNNGG	1 cut(s)	153
AlwI	GGATC	1 cut(s)	40
Ama87I	CYCGRG	1 cut(s)	21
ApoI	RAATTY	1 cut(s)	160
AvaI	CYCGRG	1 cut(s)	21
BfaI	CTAG	2 cut(s)	53, 170
BmeT110I	CYCGRG	1 cut(s)	21
BmsI	GCATC	1 cut(s)	26
BpuEI	CTTGAG	1 cut(s)	122
Bsc4I	CCNNNNNNNGG	1 cut(s)	153
Bse1I	ACTGG	1 cut(s)	74
Bse3DI	GCAATG	1 cut(s)	135
BseLI	CCNNNNNNNGG	1 cut(s)	153
BseMI	GCAATG	1 cut(s)	135
BseMII	CTCAG	1 cut(s)	72
BseNI	ACTGG	1 cut(s)	74
BsiHKCI	CYCGRG	1 cut(s)	21
BslI	CCNNNNNNNGG	1 cut(s)	153
BsoBI	CYCGRG	1 cut(s)	21
Bsp143I	GATC	2 cut(s)	32, 109
BspCNI	CTCAG	1 cut(s)	73
BspPI	GGATC	1 cut(s)	40
BsrDI	GCAATG	1 cut(s)	135
BsrI	ACTGG	1 cut(s)	74
BssMI	GATC	2 cut(s)	32, 109
BstC8I	GCNNGC	1 cut(s)	65
BstDEI	CTNAG	1 cut(s)	81
BstKTI	GATC	2 cut(s)	35, 112
BstMBI	GATC	2 cut(s)	32, 109
BtsIMutI	CAGTG	1 cut(s)	67
Cac8I	GCNNGC	1 cut(s)	65
CviJI	RGCY	1 cut(s)	7
CviKI_1	RGCY	1 cut(s)	7
DdeI	CTNAG	1 cut(s)	81
DpnI	GATC	2 cut(s)	34, 111
DpnII	GATC	2 cut(s)	32, 109
Eco57I	CTGAAG	1 cut(s)	33
Eco88I	CYCGRG	1 cut(s)	21
FaiI	YATR	1 cut(s)	128
FspBI	CTAG	2 cut(s)	53, 170
HinfI	GANTC	1 cut(s)	77
Hpy188I	TCNGA	1 cut(s)	82
Hpy188III	TCNNGA	4 cut(s)	11, 21, 101, 113
HpyCH4V	TGCA	2 cut(s)	63, 95
HpyF3I	CTNAG	1 cut(s)	81
Kzo9I	GATC	2 cut(s)	32, 109
LpnPI	CCDG	2 cut(s)	24, 55
LweI	GCATC	1 cut(s)	26
MaeI	CTAG	2 cut(s)	53, 170
MalI	GATC	2 cut(s)	34, 111
MboI	GATC	2 cut(s)	32, 109
MluCI	AATT	1 cut(s)	160
MnlI	CCTC	2 cut(s)	17, 154
MslI	CAYNNNNRTG	1 cut(s)	72
NdeII	GATC	2 cut(s)	32, 109
NmeAIII	GCCGAG	1 cut(s)	113
PaeR7I	CTCGAG	1 cut(s)	21
PfeI	GAWTC	1 cut(s)	77
RseI	CAYNNNNRTG	1 cut(s)	72
Sau3AI	GATC	2 cut(s)	32, 109
SetI	ASST	3 cut(s)	28, 58, 146
SfaNI	GCATC	1 cut(s)	26
Sfr274I	CTCGAG	1 cut(s)	21
SlaI	CTCGAG	1 cut(s)	21
SmiMI	CAYNNNNRTG	1 cut(s)	72
SmlI	CTYRAG	2 cut(s)	21, 101
SmoI	CTYRAG	2 cut(s)	21, 101
Sse9I	AATT	1 cut(s)	160
SspMI	CTAG	2 cut(s)	53, 170
TaqI	TCGA	1 cut(s)	22
TasI	AATT	1 cut(s)	160
TfiI	GAWTC	1 cut(s)	77
TscAI	CASTG	1 cut(s)	74
TspDTI	ATGAA	1 cut(s)	90
TspRI	CASTG	1 cut(s)	74
XapI	RAATTY	1 cut(s)	160
XhoI	CTCGAG	1 cut(s)	21
XspI	CTAG	2 cut(s)	53, 170

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.