Rmu_sc0000369.1_g000007

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000369.1
Physical Location & Seq
Forward (+)
32733 .. 33083
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000369.1_g000007.1.cds

Sequence Viewer

Length: 351 bp
atgctcaacattcggacgctagtatttgattatcagaatacaaataatacgagggctcctctaaccattagcatttggcaaccccctgcaatctccaagcgagaggaacgactagccgacaactctatggccaccgattggtattcccacgatgtggctcactttgagagttacataaatgctgcattccgttcgtcttgccaaaaagaagcctatctattcatgaagaacgagtatgtgctaatcgactatgcttctggcaataatgacgacaaggtattgaacagaccatttcttatatgcgatgggtttccatccctcactggcacagcctttgcagacatggtatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.3

Weight (kDa)

4.96

Isoelectric Point (pI)

38.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 138, 154
AcoI YGGCCR 1 cut(s) 129
AdeI CACNNNGTG 1 cut(s) 154
AfiI CCNNNNNNNGG 2 cut(s) 138, 154
AgsI TTSAA 1 cut(s) 283
AoxI GGCC 1 cut(s) 129
ApeKI GCWGC 1 cut(s) 182
BalI TGGCCA 1 cut(s) 131
BanII GRGCYC 1 cut(s) 58
BbvI GCAGC 1 cut(s) 169
BccI CCATC 2 cut(s) 299, 322
BcgI CGANNNNNNTGC 2 cut(s) 174, 208
BfaI CTAG 2 cut(s) 20, 113
BisI GCNGC 1 cut(s) 183
BlsI GCNGC 1 cut(s) 184
BmiI GGNNCC 1 cut(s) 57
BplI GAGNNNNNCTC 2 cut(s) 43, 75
BsaXI ACNNNNNCTCC 2 cut(s) 40, 70
Bsc4I CCNNNNNNNGG 2 cut(s) 138, 154
Bse1I ACTGG 1 cut(s) 328
BseGI GGATG 1 cut(s) 314
BseLI CCNNNNNNNGG 2 cut(s) 138, 154
BseNI ACTGG 1 cut(s) 328
BseRI GAGGAG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 169
BshFI GGCC 1 cut(s) 131
BslI CCNNNNNNNGG 2 cut(s) 138, 154
BsmI GAATGC 1 cut(s) 185
BsnI GGCC 1 cut(s) 131
Bsp1286I GDGCHC 1 cut(s) 58
BspANI GGCC 1 cut(s) 131
BspHI TCATGA 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 57
BsrI ACTGG 1 cut(s) 328
BstF5I GGATG 1 cut(s) 314
BstV1I GCAGC 1 cut(s) 169
BsuRI GGCC 1 cut(s) 131
BtgZI GCGATG 1 cut(s) 318
BtsCI GGATG 1 cut(s) 314
BtsIMutI CAGTG 1 cut(s) 321
CciI TCATGA 1 cut(s) 222
CseI GACGC 1 cut(s) 25
CviAII CATG 2 cut(s) 223, 343
CviJI RGCY 6 cut(s) 56, 116, 131, 158, 212, 332
CviKI_1 RGCY 6 cut(s) 56, 116, 131, 158, 212, 332
DraIII CACNNNGTG 1 cut(s) 154
EaeI YGGCCR 1 cut(s) 129
Eco24I GRGCYC 1 cut(s) 58
EcoT38I GRGCYC 1 cut(s) 58
FaeI CATG 2 cut(s) 226, 346
FaiI YATR 9 cut(s) 128, 176, 224, 237, 252, 299, 301, 344, 349
FatI CATG 2 cut(s) 222, 342
Fnu4HI GCNGC 1 cut(s) 183
FokI GGATG 1 cut(s) 301
FriOI GRGCYC 1 cut(s) 58
Fsp4HI GCNGC 1 cut(s) 183
FspBI CTAG 2 cut(s) 20, 113
GluI GCNGC 1 cut(s) 183
HaeIII GGCC 1 cut(s) 131
HgaI GACGC 1 cut(s) 25
Hin1II CATG 2 cut(s) 226, 346
Hpy188I TCNGA 2 cut(s) 15, 36
Hpy188III TCNNGA 1 cut(s) 223
HpyCH4V TGCA 3 cut(s) 89, 185, 338
Hsp92II CATG 2 cut(s) 226, 346
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 3 cut(s) 99, 243, 309
Lsp1109I GCAGC 1 cut(s) 169
MaeI CTAG 2 cut(s) 20, 113
MaeIII GTNAC 1 cut(s) 170
MboII GAAGA 1 cut(s) 238
MhlI GDGCHC 1 cut(s) 58
MlsI TGGCCA 1 cut(s) 131
MluNI TGGCCA 1 cut(s) 131
MnlI CCTC 4 cut(s) 45, 69, 97, 329
Mox20I TGGCCA 1 cut(s) 131
MscI TGGCCA 1 cut(s) 131
Msp20I TGGCCA 1 cut(s) 131
Mva1269I GAATGC 1 cut(s) 185
NlaIII CATG 2 cut(s) 226, 346
NlaIV GGNNCC 1 cut(s) 57
PagI TCATGA 1 cut(s) 222
PctI GAATGC 1 cut(s) 185
PflMI CCANNNNNTGG 2 cut(s) 138, 154
PkrI GCNGC 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 57
SatI GCNGC 1 cut(s) 183
SduI GDGCHC 1 cut(s) 58
SetI ASST 1 cut(s) 279
SspMI CTAG 2 cut(s) 20, 113
TaqI TCGA 1 cut(s) 246
TscAI CASTG 1 cut(s) 328
TseI GCWGC 1 cut(s) 182
TspDTI ATGAA 2 cut(s) 211, 239
TspGWI ACGGA 1 cut(s) 179
TspRI CASTG 1 cut(s) 328
Van91I CCANNNNNTGG 2 cut(s) 138, 154
XspI CTAG 2 cut(s) 20, 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.