Rmu_sc0000493.1_g000079

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000493.1
OG0002397
Physical Location & Seq
Reverse (-)
365939 .. 368223
2285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000493.1_g000079.1.cds

Sequence Viewer

Length: 810 bp
atgggtgaggctccaactttgattattaagactttgaacaacaagcacacttgttctccagtggaaacaagccatttcttggattataacacgaatgcaaaagaggtacaagaagatatattggtatatgagaattggtccagagctggcatccacaatcacatagagaagaaatacaagttggatgtggaggtacaaaccatcacaagagctaagagaaaaccaaagaggatgaatagggccactacattgagcagttggtttctaaatgctgaacataggcaccgtgtgaggcatctttacaacaatttcaaggccaagcatccaagagaggggctgaagcagttggtttggaatgcagcgagatccagcactgctgtagtatgtgggaaggaaggacacaacaagctagttgtccaatcactcaggcagcaaagacagaagcatcaggagaaggttcatcaaatggaccaaatattggatattattgtgtaccgcaaaagagcatatcttacaaaggggtgttctaattttaaaaagcaaatcataaggtcaaggaaaacatggaagaaggtcaaggatgctgtttgtggtacttttggtgttaataccaatgcatcaacctcacaaacaatgcagcaacctcctactcaaatcagccaagatcctgctacaagaggtgcacaaaagaaatcatcccagcctatgcaaccaaggcaagcttcctctgattgggcggtttttaaacctaaacctattgagtttgctgtttcttggcctattttgattgcaacactttggaatctttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

269

Amino Acids

31.09

Weight (kDa)

10.21

Isoelectric Point (pI)

39.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 87
AccB1I GGYRCC 1 cut(s) 282
AccB7I CCANNNNNTGG 2 cut(s) 79, 478
AciI CCGC 2 cut(s) 496, 737
AclWI GGATC 2 cut(s) 360, 659
AcuI CTGAAG 1 cut(s) 359
AdeI CACNNNGTG 1 cut(s) 289
AfaI GTAC 4 cut(s) 108, 195, 494, 595
AfiI CCNNNNNNNGG 4 cut(s) 79, 332, 478, 732
AgsI TTSAA 2 cut(s) 37, 313
AjuI GAANNNNNNNTTGG 4 cut(s) 164, 196, 706, 738
AluBI AGCT 4 cut(s) 146, 212, 409, 722
AluI AGCT 4 cut(s) 146, 212, 409, 722
Alw21I GWGCWC 1 cut(s) 685
Alw44I GTGCAC 1 cut(s) 681
AlwI GGATC 2 cut(s) 360, 659
AoxI GGCC 3 cut(s) 240, 315, 776
ApaLI GTGCAC 1 cut(s) 681
ApeKI GCWGC 3 cut(s) 359, 430, 637
AspS9I GGNCC 3 cut(s) 138, 240, 469
AsuHPI GGTGA 1 cut(s) 17
AvaII GGWCC 2 cut(s) 138, 469
BaeGI GKGCMC 1 cut(s) 685
BanI GGYRCC 1 cut(s) 282
Bbv12I GWGCWC 1 cut(s) 685
BbvI GCAGC 3 cut(s) 371, 442, 649
BccI CCATC 1 cut(s) 209
BfaI CTAG 1 cut(s) 410
BfmI CTRYAG 1 cut(s) 378
BisI GCNGC 3 cut(s) 360, 431, 638
BlsI GCNGC 3 cut(s) 361, 432, 639
Bme18I GGWCC 2 cut(s) 138, 469
BmgT120I GGNCC 3 cut(s) 138, 240, 469
BmiI GGNNCC 2 cut(s) 12, 284
BmsI GCATC 6 cut(s) 159, 304, 331, 454, 571, 626
BpmI CTGGAG 1 cut(s) 42
BsaJI CCNNGG 1 cut(s) 713
BsaXI ACNNNNNCTCC 2 cut(s) 40, 70
Bsc4I CCNNNNNNNGG 4 cut(s) 79, 332, 478, 732
Bse1I ACTGG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 713
BseGI GGATG 6 cut(s) 150, 190, 237, 322, 586, 695
BseLI CCNNNNNNNGG 4 cut(s) 79, 332, 478, 732
BseMII CTCAG 1 cut(s) 439
BseNI ACTGG 1 cut(s) 59
BseSI GKGCMC 1 cut(s) 685
BseXI GCAGC 3 cut(s) 371, 442, 649
BseYI CCCAGC 1 cut(s) 699
BshFI GGCC 3 cut(s) 242, 317, 778
BshNI GGYRCC 1 cut(s) 282
BsiHKAI GWGCWC 1 cut(s) 685
BslI CCNNNNNNNGG 4 cut(s) 79, 332, 478, 732
BsmI GAATGC 2 cut(s) 100, 361
BsnI GGCC 3 cut(s) 242, 317, 778
Bsp1286I GDGCHC 1 cut(s) 685
Bsp143I GATC 2 cut(s) 365, 664
BspACI CCGC 2 cut(s) 496, 737
BspANI GGCC 3 cut(s) 242, 317, 778
BspCNI CTCAG 1 cut(s) 438
BspLI GGNNCC 2 cut(s) 12, 284
BspPI GGATC 2 cut(s) 360, 659
BspT107I GGYRCC 1 cut(s) 282
BsrI ACTGG 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 713
BssMI GATC 2 cut(s) 365, 664
BssT1I CCWWGG 1 cut(s) 713
Bst4CI ACNGT 1 cut(s) 287
BstC8I GCNNGC 2 cut(s) 148, 720
BstDEI CTNAG 2 cut(s) 213, 425
BstF5I GGATG 6 cut(s) 150, 190, 237, 322, 586, 695
BstKTI GATC 2 cut(s) 368, 667
BstMBI GATC 2 cut(s) 365, 664
BstMWI GCNNNNNNNGC 1 cut(s) 715
BstSFI CTRYAG 1 cut(s) 378
BstSLI GKGCMC 1 cut(s) 685
BstV1I GCAGC 3 cut(s) 371, 442, 649
BstX2I RGATCY 2 cut(s) 365, 664
BstYI RGATCY 2 cut(s) 365, 664
BsuRI GGCC 3 cut(s) 242, 317, 778
BtsCI GGATG 6 cut(s) 150, 190, 237, 322, 586, 695
BtsI GCAGTG 1 cut(s) 372
BtsIMutI CAGTG 2 cut(s) 66, 372
Cac8I GCNNGC 2 cut(s) 148, 720
Cfr13I GGNCC 3 cut(s) 138, 240, 469
Csp6I GTAC 4 cut(s) 107, 194, 493, 594
CviAII CATG 1 cut(s) 564
CviQI GTAC 4 cut(s) 107, 194, 493, 594
DdeI CTNAG 2 cut(s) 213, 425
DpnI GATC 2 cut(s) 367, 666
DpnII GATC 2 cut(s) 365, 664
DraI TTTAAA 2 cut(s) 535, 745
DraIII CACNNNGTG 1 cut(s) 289
Eco130I CCWWGG 1 cut(s) 713
Eco47I GGWCC 2 cut(s) 138, 469
Eco57I CTGAAG 1 cut(s) 359
EcoT14I CCWWGG 1 cut(s) 713
EcoT22I ATGCAT 1 cut(s) 619
ErhI CCWWGG 1 cut(s) 713
FaeI CATG 1 cut(s) 567
FalI AAGNNNNNCTT 2 cut(s) 706, 738
FatI CATG 1 cut(s) 563
Fnu4HI GCNGC 3 cut(s) 360, 431, 638
FokI GGATG 6 cut(s) 137, 197, 244, 309, 593, 682
Fsp4HI GCNGC 3 cut(s) 360, 431, 638
FspBI CTAG 1 cut(s) 410
GluI GCNGC 3 cut(s) 360, 431, 638
GsaI CCCAGC 1 cut(s) 703
GsuI CTGGAG 1 cut(s) 42
HaeIII GGCC 3 cut(s) 242, 317, 778
Hin1II CATG 1 cut(s) 567
HindIII AAGCTT 1 cut(s) 720
HinfI GANTC 1 cut(s) 802
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 2 cut(s) 493, 683
Hpy188I TCNGA 1 cut(s) 730
Hpy188III TCNNGA 2 cut(s) 141, 449
Hpy8I GTNNAC 2 cut(s) 493, 683
HpyAV CCTTC 4 cut(s) 385, 389, 448, 565
HpyCH4III ACNGT 1 cut(s) 287
HpyCH4V TGCA 7 cut(s) 98, 359, 617, 637, 683, 709, 791
HpyF10VI GCNNNNNNNGC 1 cut(s) 715
HpyF3I CTNAG 2 cut(s) 213, 425
Hsp92II CATG 1 cut(s) 567
Kzo9I GATC 2 cut(s) 365, 664
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 8 cut(s) 72, 132, 154, 382, 412, 434, 681, 713
Lsp1109I GCAGC 3 cut(s) 371, 442, 649
LweI GCATC 6 cut(s) 159, 304, 331, 454, 571, 626
MaeI CTAG 1 cut(s) 410
MalI GATC 2 cut(s) 367, 666
MboI GATC 2 cut(s) 365, 664
MboII GAAGA 3 cut(s) 125, 181, 580
MflI RGATCY 2 cut(s) 365, 664
MhlI GDGCHC 1 cut(s) 685
MluCI AATT 3 cut(s) 133, 307, 529
MmeI TCCRAC 2 cut(s) 38, 162
MnlI CCTC 9 cut(s) 97, 184, 222, 285, 325, 634, 654, 671, 736
Mph1103I ATGCAT 1 cut(s) 619
MseI TTAA 5 cut(s) 27, 534, 606, 744, 808
Mva1269I GAATGC 2 cut(s) 100, 361
MwoI GCNNNNNNNGC 1 cut(s) 715
NdeII GATC 2 cut(s) 365, 664
NlaIII CATG 1 cut(s) 567
NlaIV GGNNCC 2 cut(s) 12, 284
NsiI ATGCAT 1 cut(s) 619
PctI GAATGC 2 cut(s) 100, 361
PfeI GAWTC 1 cut(s) 802
PflMI CCANNNNNTGG 2 cut(s) 79, 478
PkrI GCNGC 3 cut(s) 361, 432, 639
PsiI TTATAA 1 cut(s) 87
PspFI CCCAGC 1 cut(s) 699
PspN4I GGNNCC 2 cut(s) 12, 284
PspPI GGNCC 3 cut(s) 138, 240, 469
PsuI RGATCY 2 cut(s) 365, 664
RsaI GTAC 4 cut(s) 108, 195, 494, 595
RsaNI GTAC 4 cut(s) 107, 194, 493, 594
SaqAI TTAA 5 cut(s) 27, 534, 606, 744, 808
SatI GCNGC 3 cut(s) 360, 431, 638
Sau3AI GATC 2 cut(s) 365, 664
Sau96I GGNCC 3 cut(s) 138, 240, 469
SduI GDGCHC 1 cut(s) 685
SfaNI GCATC 6 cut(s) 159, 304, 331, 454, 571, 626
SfcI CTRYAG 1 cut(s) 378
SinI GGWCC 2 cut(s) 138, 469
Sse9I AATT 3 cut(s) 133, 307, 529
SsiI CCGC 2 cut(s) 496, 737
SspI AATATT 1 cut(s) 477
SspMI CTAG 1 cut(s) 410
StyI CCWWGG 1 cut(s) 713
TaaI ACNGT 1 cut(s) 287
TasI AATT 3 cut(s) 133, 307, 529
TfiI GAWTC 1 cut(s) 802
Tru1I TTAA 5 cut(s) 27, 534, 606, 744, 808
Tru9I TTAA 5 cut(s) 27, 534, 606, 744, 808
TscAI CASTG 2 cut(s) 66, 379
TseI GCWGC 3 cut(s) 359, 430, 637
TspDTI ATGAA 2 cut(s) 248, 449
TspRI CASTG 2 cut(s) 66, 379
Van91I CCANNNNNTGG 2 cut(s) 79, 478
VneI GTGCAC 1 cut(s) 681
VpaK11BI GGWCC 2 cut(s) 138, 469
XspI CTAG 1 cut(s) 410
Zsp2I ATGCAT 1 cut(s) 619
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.