Rh4BG256900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0002397
Physical Location & Seq
Forward (+)
42850945 .. 42851595
651 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG256900.1

Sequence Viewer

Length: 285 bp
ATGTCCTGCAAGATCTGTGGCCAGCACGGACACAACAGATTGGGTTGTCCTGTAACAAAGGCAAAAAAGGCAGCTGCAACTGTTAAAAGAGCCCCTGCCCCTAAGAGGAGCACTAATGTGAAGGATCAAGTCATAAGGTCCAGGAAAACATGGAACAAATTAAAGACCACAATGGAGAGTACTTCTAGTCCCAATGTTGGTGCATCAACTTCCCAATCTACTCACCAACCTCCTACTCAAAGTAGCCAGAATCCTGCAGCAAGAAGTACTGCAAGGAAGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.09

Weight (kDa)

11.41

Isoelectric Point (pI)

75.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 132
AcoI YGGCCR 1 cut(s) 19
AfaI GTAC 2 cut(s) 181, 268
AfiI CCNNNNNNNGG 2 cut(s) 105, 197
AjnI CCWGG 1 cut(s) 140
AleI CACNNNNGTG 1 cut(s) 116
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 113
AlwI GGATC 1 cut(s) 132
AoxI GGCC 1 cut(s) 19
ApeKI GCWGC 3 cut(s) 71, 74, 257
AspS9I GGNCC 1 cut(s) 138
AsuHPI GGTGA 1 cut(s) 215
AvaII GGWCC 1 cut(s) 138
BalI TGGCCA 1 cut(s) 21
BanII GRGCYC 1 cut(s) 94
Bbv12I GWGCWC 1 cut(s) 113
BbvI GCAGC 3 cut(s) 61, 83, 269
BciT130I CCWGG 1 cut(s) 142
BfaI CTAG 1 cut(s) 186
BfmI CTRYAG 1 cut(s) 255
BglII AGATCT 1 cut(s) 12
BisI GCNGC 3 cut(s) 72, 75, 258
BlsI GCNGC 3 cut(s) 73, 76, 259
BmcAI AGTACT 2 cut(s) 181, 268
Bme1390I CCNGG 1 cut(s) 142
Bme18I GGWCC 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 138
BmrFI CCNGG 1 cut(s) 142
BmsI GCATC 1 cut(s) 212
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 197
BseBI CCWGG 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 105, 197
BseRI GAGGAG 1 cut(s) 121
BseXI GCAGC 3 cut(s) 61, 83, 269
BshFI GGCC 1 cut(s) 21
BsiHKAI GWGCWC 1 cut(s) 113
BslFI GGGAC 1 cut(s) 174
BslI CCNNNNNNNGG 2 cut(s) 105, 197
BsmFI GGGAC 1 cut(s) 174
BsnI GGCC 1 cut(s) 21
Bsp1286I GDGCHC 2 cut(s) 94, 113
Bsp143I GATC 2 cut(s) 12, 124
BspANI GGCC 1 cut(s) 21
BspMAI CTGCAG 1 cut(s) 259
BspPI GGATC 1 cut(s) 132
BssMI GATC 2 cut(s) 12, 124
Bst2UI CCWGG 1 cut(s) 142
Bst4CI ACNGT 1 cut(s) 82
Bst6I CTCTTC 1 cut(s) 272
BstC8I GCNNGC 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 2 cut(s) 15, 127
BstMBI GATC 2 cut(s) 12, 124
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 142
BstSCI CCNGG 1 cut(s) 140
BstSFI CTRYAG 1 cut(s) 255
BstV1I GCAGC 3 cut(s) 61, 83, 269
BstX2I RGATCY 1 cut(s) 12
BstYI RGATCY 1 cut(s) 12
BsuRI GGCC 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 23
Cfr13I GGNCC 1 cut(s) 138
Csp6I GTAC 2 cut(s) 180, 267
CspCI CAANNNNNGTGG 1 cut(s) 33
CviAII CATG 1 cut(s) 150
CviJI RGCY 4 cut(s) 21, 74, 92, 246
CviKI_1 RGCY 4 cut(s) 21, 74, 92, 246
CviQI GTAC 2 cut(s) 180, 267
DdeI CTNAG 1 cut(s) 102
DpnI GATC 2 cut(s) 14, 126
DpnII GATC 2 cut(s) 12, 124
EaeI YGGCCR 1 cut(s) 19
Eam1104I CTCTTC 1 cut(s) 272
EarI CTCTTC 1 cut(s) 272
Eco24I GRGCYC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 140
EcoT38I GRGCYC 1 cut(s) 94
FaeI CATG 1 cut(s) 153
FaiI YATR 2 cut(s) 134, 151
FaqI GGGAC 1 cut(s) 174
FatI CATG 1 cut(s) 149
Fnu4HI GCNGC 3 cut(s) 72, 75, 258
FriOI GRGCYC 1 cut(s) 94
Fsp4HI GCNGC 3 cut(s) 72, 75, 258
FspBI CTAG 1 cut(s) 186
GluI GCNGC 3 cut(s) 72, 75, 258
HaeIII GGCC 1 cut(s) 21
Hin1II CATG 1 cut(s) 153
HinfI GANTC 1 cut(s) 250
HphI GGTGA 1 cut(s) 215
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4V TGCA 5 cut(s) 9, 77, 203, 257, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 1 cut(s) 153
Kzo9I GATC 2 cut(s) 12, 124
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 8 cut(s) 19, 35, 63, 108, 127, 154, 260, 267
Lsp1109I GCAGC 3 cut(s) 61, 83, 269
LweI GCATC 1 cut(s) 212
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 1 cut(s) 52
MalI GATC 2 cut(s) 14, 126
MboI GATC 2 cut(s) 12, 124
MflI RGATCY 1 cut(s) 12
MhlI GDGCHC 2 cut(s) 94, 113
MlsI TGGCCA 1 cut(s) 21
MluCI AATT 1 cut(s) 158
MluNI TGGCCA 1 cut(s) 21
MnlI CCTC 2 cut(s) 99, 240
Mox20I TGGCCA 1 cut(s) 21
MscI TGGCCA 1 cut(s) 21
MseI TTAA 3 cut(s) 84, 161, 283
MslI CAYNNNNRTG 1 cut(s) 116
Msp20I TGGCCA 1 cut(s) 21
MspA1I CMGCKG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 142
MvaI CCWGG 1 cut(s) 142
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 2 cut(s) 12, 124
NlaIII CATG 1 cut(s) 153
OliI CACNNNNGTG 1 cut(s) 116
PfeI GAWTC 1 cut(s) 250
PfoI TCCNGGA 1 cut(s) 140
PkrI GCNGC 3 cut(s) 73, 76, 259
Psp6I CCWGG 1 cut(s) 140
PspGI CCWGG 1 cut(s) 140
PspPI GGNCC 1 cut(s) 138
PstI CTGCAG 1 cut(s) 259
PsuI RGATCY 1 cut(s) 12
PvuII CAGCTG 1 cut(s) 74
RsaI GTAC 2 cut(s) 181, 268
RsaNI GTAC 2 cut(s) 180, 267
RseI CAYNNNNRTG 1 cut(s) 116
SaqAI TTAA 3 cut(s) 84, 161, 283
SatI GCNGC 3 cut(s) 72, 75, 258
Sau3AI GATC 2 cut(s) 12, 124
Sau96I GGNCC 1 cut(s) 138
ScaI AGTACT 2 cut(s) 181, 268
ScrFI CCNGG 1 cut(s) 142
SduI GDGCHC 2 cut(s) 94, 113
SetI ASST 3 cut(s) 76, 140, 232
SfaNI GCATC 1 cut(s) 212
SfcI CTRYAG 1 cut(s) 255
SinI GGWCC 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 116
Sse9I AATT 1 cut(s) 158
SspMI CTAG 1 cut(s) 186
StyD4I CCNGG 1 cut(s) 140
TaaI ACNGT 1 cut(s) 82
TasI AATT 1 cut(s) 158
TatI WGTACW 2 cut(s) 179, 266
TfiI GAWTC 1 cut(s) 250
Tru1I TTAA 3 cut(s) 84, 161, 283
Tru9I TTAA 3 cut(s) 84, 161, 283
TseI GCWGC 3 cut(s) 71, 74, 257
TspGWI ACGGA 1 cut(s) 42
VpaK11BI GGWCC 1 cut(s) 138
XspI CTAG 1 cut(s) 186
ZrmI AGTACT 2 cut(s) 181, 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.