Rh3AG287600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0002397
Physical Location & Seq
Forward (+)
34417601 .. 34424753
7153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG287600.1

Sequence Viewer

Length: 174 bp
ATGACACCAATCAGATCAAGGAAACCTAGGTTTCCAACCTCTACCCTAGCTCTGAGAAACCAGGGAGAAGGAACATCAAGTGGAGCAGCCACGAAGAAAAGGCAGAGAAAAGAGGTTCGTACTTATGGATTTTTTTGGACTTGGTTGTCTGAATTTGGTGTTTATGTTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.6

Weight (kDa)

10.96

Isoelectric Point (pI)

28.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 145
AcsI RAATTY 1 cut(s) 152
AfaI GTAC 1 cut(s) 121
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
ApeKI GCWGC 1 cut(s) 86
ApoI RAATTY 1 cut(s) 152
AspA2I CCTAGG 1 cut(s) 26
AvrII CCTAGG 1 cut(s) 26
BbvI GCAGC 1 cut(s) 98
BciT130I CCWGG 1 cut(s) 62
BfaI CTAG 2 cut(s) 27, 47
BisI GCNGC 1 cut(s) 87
BlnI CCTAGG 1 cut(s) 26
BlsI GCNGC 1 cut(s) 88
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BsaJI CCNNGG 2 cut(s) 26, 61
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 2 cut(s) 26, 61
BseMII CTCAG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 98
Bsp143I GATC 1 cut(s) 14
BspCNI CTCAG 1 cut(s) 45
BssECI CCNNGG 2 cut(s) 26, 61
BssMI GATC 1 cut(s) 14
BssT1I CCWWGG 1 cut(s) 26
Bst2UI CCWGG 1 cut(s) 62
BstDEI CTNAG 1 cut(s) 53
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
BstNI CCWGG 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 60
BstV1I GCAGC 1 cut(s) 98
Csp6I GTAC 1 cut(s) 120
CviJI RGCY 2 cut(s) 50, 89
CviKI_1 RGCY 2 cut(s) 50, 89
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 1 cut(s) 53
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
DrdI GACNNNNNNGTC 1 cut(s) 145
DseDI GACNNNNNNGTC 1 cut(s) 145
Eco130I CCWWGG 1 cut(s) 26
EcoRII CCWGG 1 cut(s) 60
EcoT14I CCWWGG 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 26
FaiI YATR 2 cut(s) 126, 165
Fnu4HI GCNGC 1 cut(s) 87
Fsp4HI GCNGC 1 cut(s) 87
FspBI CTAG 2 cut(s) 27, 47
GluI GCNGC 1 cut(s) 87
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 3 cut(s) 14, 54, 151
Hpy8I GTNNAC 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 62
HpyF3I CTNAG 1 cut(s) 53
Kzo9I GATC 1 cut(s) 14
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 2 cut(s) 47, 74
Lsp1109I GCAGC 1 cut(s) 98
MaeI CTAG 2 cut(s) 27, 47
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 1 cut(s) 106
MluCI AATT 1 cut(s) 152
MmeI TCCRAC 1 cut(s) 59
MnlI CCTC 2 cut(s) 49, 106
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
NdeII GATC 1 cut(s) 14
PkrI GCNGC 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SatI GCNGC 1 cut(s) 87
Sau3AI GATC 1 cut(s) 14
ScrFI CCNGG 1 cut(s) 62
SetI ASST 5 cut(s) 28, 32, 41, 52, 117
SgeI CNNG 8 cut(s) 30, 39, 59, 73, 74, 90, 103, 153
Sse9I AATT 1 cut(s) 152
SspMI CTAG 2 cut(s) 27, 47
StyD4I CCNGG 1 cut(s) 60
StyI CCWWGG 1 cut(s) 26
TasI AATT 1 cut(s) 152
TseI GCWGC 1 cut(s) 86
XapI RAATTY 1 cut(s) 152
XmaJI CCTAGG 1 cut(s) 26
XspI CTAG 2 cut(s) 27, 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.