Rh1BG304600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0002397
Physical Location & Seq
Forward (+)
44054573 .. 44055419
847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG304600.1

Sequence Viewer

Length: 378 bp
ATGTCCTGCAAAATATGTGGCCAGCAAGGACACAACAAATTGGGTTGTCCTATAACAAAGGCCAAAAAGGCAGCAGGAGAAGGAACATCAAGTGGAGCAGCTCCAAACAAGAGGCAGAGAAATGAGGTCAACAGAGCAGCTGCACCAAAGGGGTCTACTAACGTCAAGGACCAAGTTATCAAGTCTAGGAAAACATGGAAGAAAATCAAGCAAACTGTGGAGAGTACTTCGGGTCCCAATGTTGGTGCCTCAACATCACAATCAAATCAGCAGCCTCCCACTCAAAGTAGCCAGAATCCGGCAGCTGGGAGTGCTCAATGGAAAGAATCAGAGCCTATGCAACCAAGCCAAGCTTCATCTAAATATGCAGCATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.16

Weight (kDa)

10.13

Isoelectric Point (pI)

56.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 245
AccI GTMKAC 1 cut(s) 155
AcoI YGGCCR 1 cut(s) 19
AfaI GTAC 1 cut(s) 226
AfiI CCNNNNNNNGG 3 cut(s) 242, 298, 305
AjuI GAANNNNNNNTTGG 2 cut(s) 337, 369
AluBI AGCT 4 cut(s) 101, 140, 305, 353
AluI AGCT 4 cut(s) 101, 140, 305, 353
Alw21I GWGCWC 1 cut(s) 316
AoxI GGCC 2 cut(s) 19, 60
ApeKI GCWGC 7 cut(s) 71, 98, 137, 140, 271, 302, 368
AspS9I GGNCC 2 cut(s) 169, 233
AvaII GGWCC 2 cut(s) 169, 233
BalI TGGCCA 1 cut(s) 21
BanI GGYRCC 1 cut(s) 245
Bbv12I GWGCWC 1 cut(s) 316
BbvI GCAGC 6 cut(s) 83, 110, 127, 149, 283, 314
BfaI CTAG 1 cut(s) 186
BglI GCCNNNNNGGC 1 cut(s) 68
BisI GCNGC 7 cut(s) 72, 99, 138, 141, 272, 303, 369
BlsI GCNGC 7 cut(s) 73, 100, 139, 142, 273, 304, 370
BmcAI AGTACT 1 cut(s) 226
Bme18I GGWCC 2 cut(s) 169, 233
BmgT120I GGNCC 2 cut(s) 169, 233
BmiI GGNNCC 3 cut(s) 234, 235, 247
Bsc4I CCNNNNNNNGG 3 cut(s) 242, 298, 305
BseLI CCNNNNNNNGG 3 cut(s) 242, 298, 305
BseXI GCAGC 6 cut(s) 83, 110, 127, 149, 283, 314
BseYI CCCAGC 1 cut(s) 305
BsgI GTGCAG 1 cut(s) 126
BshFI GGCC 2 cut(s) 21, 62
BshNI GGYRCC 1 cut(s) 245
BsiHKAI GWGCWC 1 cut(s) 316
BsiSI CCGG 1 cut(s) 299
BslFI GGGAC 1 cut(s) 219
BslI CCNNNNNNNGG 3 cut(s) 242, 298, 305
BsmFI GGGAC 1 cut(s) 219
BsnI GGCC 2 cut(s) 21, 62
Bsp1286I GDGCHC 1 cut(s) 316
BspANI GGCC 2 cut(s) 21, 62
BspLI GGNNCC 3 cut(s) 234, 235, 247
BspT107I GGYRCC 1 cut(s) 245
Bst4CI ACNGT 1 cut(s) 217
BstC8I GCNNGC 1 cut(s) 23
BstMWI GCNNNNNNNGC 2 cut(s) 68, 311
BstV1I GCAGC 6 cut(s) 83, 110, 127, 149, 283, 314
BsuRI GGCC 2 cut(s) 21, 62
Cac8I GCNNGC 1 cut(s) 23
Cfr13I GGNCC 2 cut(s) 169, 233
Csp6I GTAC 1 cut(s) 225
CspCI CAANNNNNGTGG 1 cut(s) 33
CviAII CATG 1 cut(s) 195
CviQI GTAC 1 cut(s) 225
EaeI YGGCCR 1 cut(s) 19
Eco47I GGWCC 2 cut(s) 169, 233
EcoO109I RGGNCCY 1 cut(s) 233
FaeI CATG 1 cut(s) 198
FaiI YATR 5 cut(s) 16, 53, 196, 338, 366
FalI AAGNNNNNCTT 2 cut(s) 337, 369
FaqI GGGAC 1 cut(s) 219
FatI CATG 1 cut(s) 194
FblI GTMKAC 1 cut(s) 155
Fnu4HI GCNGC 7 cut(s) 72, 99, 138, 141, 272, 303, 369
Fsp4HI GCNGC 7 cut(s) 72, 99, 138, 141, 272, 303, 369
FspBI CTAG 1 cut(s) 186
GluI GCNGC 7 cut(s) 72, 99, 138, 141, 272, 303, 369
GsaI CCCAGC 1 cut(s) 309
HaeIII GGCC 2 cut(s) 21, 62
HapII CCGG 1 cut(s) 299
Hin1II CATG 1 cut(s) 198
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HindIII AAGCTT 1 cut(s) 351
HinfI GANTC 2 cut(s) 295, 326
HpaII CCGG 1 cut(s) 299
Hpy166II GTNNAC 2 cut(s) 130, 156
Hpy188I TCNGA 1 cut(s) 331
Hpy8I GTNNAC 2 cut(s) 130, 156
HpyAV CCTTC 1 cut(s) 74
HpyCH4III ACNGT 1 cut(s) 217
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 4 cut(s) 9, 143, 340, 368
HpyF10VI GCNNNNNNNGC 2 cut(s) 68, 311
HpySE526I ACGT 1 cut(s) 162
Hsp92II CATG 1 cut(s) 198
KflI GGGWCCC 1 cut(s) 233
LmnI GCTCC 2 cut(s) 95, 106
LpnPI CCDG 6 cut(s) 19, 35, 60, 291, 305, 312
Lsp1109I GCAGC 6 cut(s) 83, 110, 127, 149, 283, 314
MaeI CTAG 1 cut(s) 186
MaeII ACGT 1 cut(s) 162
MboII GAAGA 1 cut(s) 211
MhlI GDGCHC 1 cut(s) 316
MlsI TGGCCA 1 cut(s) 21
MluCI AATT 1 cut(s) 38
MluNI TGGCCA 1 cut(s) 21
MnlI CCTC 4 cut(s) 105, 118, 259, 285
Mox20I TGGCCA 1 cut(s) 21
MscI TGGCCA 1 cut(s) 21
MseI TTAA 1 cut(s) 376
Msp20I TGGCCA 1 cut(s) 21
MspA1I CMGCKG 2 cut(s) 140, 305
MspI CCGG 1 cut(s) 299
MwoI GCNNNNNNNGC 2 cut(s) 68, 311
NlaIII CATG 1 cut(s) 198
NlaIV GGNNCC 3 cut(s) 234, 235, 247
PfeI GAWTC 2 cut(s) 295, 326
PkrI GCNGC 7 cut(s) 73, 100, 139, 142, 273, 304, 370
PpuMI RGGWCCY 1 cut(s) 233
Psp5II RGGWCCY 1 cut(s) 233
PspFI CCCAGC 1 cut(s) 305
PspN4I GGNNCC 3 cut(s) 234, 235, 247
PspPI GGNCC 2 cut(s) 169, 233
PspPPI RGGWCCY 1 cut(s) 233
PvuII CAGCTG 2 cut(s) 140, 305
RsaI GTAC 1 cut(s) 226
RsaNI GTAC 1 cut(s) 225
SaqAI TTAA 1 cut(s) 376
SatI GCNGC 7 cut(s) 72, 99, 138, 141, 272, 303, 369
Sau96I GGNCC 2 cut(s) 169, 233
ScaI AGTACT 1 cut(s) 226
SduI GDGCHC 1 cut(s) 316
SetI ASST 6 cut(s) 103, 129, 142, 165, 307, 355
SinI GGWCC 2 cut(s) 169, 233
Sse9I AATT 1 cut(s) 38
SspMI CTAG 1 cut(s) 186
TaaI ACNGT 1 cut(s) 217
TaiI ACGT 1 cut(s) 165
TasI AATT 1 cut(s) 38
TatI WGTACW 1 cut(s) 224
TfiI GAWTC 2 cut(s) 295, 326
Tru1I TTAA 1 cut(s) 376
Tru9I TTAA 1 cut(s) 376
TseI GCWGC 7 cut(s) 71, 98, 137, 140, 271, 302, 368
TspDTI ATGAA 1 cut(s) 345
VpaK11BI GGWCC 2 cut(s) 169, 233
XmiI GTMKAC 1 cut(s) 155
XspI CTAG 1 cut(s) 186
ZrmI AGTACT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.