Rmu_sc0000566.1_g000017

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000566.1
OG0004838
Physical Location & Seq
Reverse (-)
65203 .. 65592
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000566.1_g000017.1.cds

Sequence Viewer

Length: 390 bp
atggtagctgaaaccattgcttcgaaggattcccccattagggttttggagaaaaatattttggataacggaaagttggaattaatggtccctaatggcaatgccgattatcaaaacgacaataccatcgttggatctataatcgttgaaaccacgccttcccgttcaaactttctccaaagcgacggtgtagtggtcagatcaaagatagttgaaacgactcctttgagttcgagctgtcccaaaattagggttttggaggacaatataatgggtgatggatacttgaatttgatgaacgacaccgtttttcctgtcaaaccaggcgagtatcgcggaaggactaatggtggatctgaggtggggggggatgagttgggagatgattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

13.92

Weight (kDa)

4.47

Isoelectric Point (pI)

36.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 336
AciI CCGC 1 cut(s) 336
AclWI GGATC 2 cut(s) 142, 361
AcsI RAATTY 1 cut(s) 289
AfiI CCNNNNNNNGG 3 cut(s) 39, 40, 249
AgsI TTSAA 4 cut(s) 149, 168, 215, 289
AjnI CCWGG 1 cut(s) 322
AjuI GAANNNNNNNTTGG 2 cut(s) 44, 76
AluBI AGCT 2 cut(s) 8, 237
AluI AGCT 2 cut(s) 8, 237
AlwI GGATC 2 cut(s) 142, 361
ApoI RAATTY 1 cut(s) 289
AseI ATTAAT 1 cut(s) 83
AspS9I GGNCC 1 cut(s) 88
AsuHPI GGTGA 1 cut(s) 287
AsuII TTCGAA 1 cut(s) 23
AvaII GGWCC 1 cut(s) 88
BccI CCATC 2 cut(s) 134, 272
BciT130I CCWGG 1 cut(s) 324
BciVI GTATCC 1 cut(s) 275
BfuI GTATCC 1 cut(s) 275
Bme1390I CCNGG 1 cut(s) 324
Bme18I GGWCC 1 cut(s) 88
BmgT120I GGNCC 1 cut(s) 88
BmiI GGNNCC 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 324
Bpu14I TTCGAA 1 cut(s) 23
Bsc4I CCNNNNNNNGG 3 cut(s) 39, 40, 249
Bse3DI GCAATG 2 cut(s) 15, 106
BseBI CCWGG 1 cut(s) 324
BseGI GGATG 1 cut(s) 376
BseLI CCNNNNNNNGG 3 cut(s) 39, 40, 249
BseMI GCAATG 2 cut(s) 15, 106
BseMII CTCAG 1 cut(s) 348
Bsh1236I CGCG 1 cut(s) 336
BslFI GGGAC 2 cut(s) 74, 225
BslI CCNNNNNNNGG 3 cut(s) 39, 40, 249
BsmFI GGGAC 2 cut(s) 74, 225
Bsp119I TTCGAA 1 cut(s) 23
Bsp143I GATC 3 cut(s) 134, 200, 353
BspACI CCGC 1 cut(s) 336
BspCNI CTCAG 1 cut(s) 349
BspFNI CGCG 1 cut(s) 336
BspLI GGNNCC 1 cut(s) 90
BspPI GGATC 2 cut(s) 142, 361
BspT104I TTCGAA 1 cut(s) 23
BsrDI GCAATG 2 cut(s) 15, 106
BssMI GATC 3 cut(s) 134, 200, 353
Bst2UI CCWGG 1 cut(s) 324
Bst4CI ACNGT 2 cut(s) 188, 307
BstBI TTCGAA 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 357
BstF5I GGATG 1 cut(s) 376
BstFNI CGCG 1 cut(s) 336
BstKTI GATC 3 cut(s) 137, 203, 356
BstMBI GATC 3 cut(s) 134, 200, 353
BstMWI GCNNNNNNNGC 1 cut(s) 333
BstNI CCWGG 1 cut(s) 324
BstSCI CCNGG 1 cut(s) 322
BstUI CGCG 1 cut(s) 336
BstX2I RGATCY 2 cut(s) 134, 353
BstYI RGATCY 2 cut(s) 134, 353
BsuI GTATCC 1 cut(s) 275
BtsCI GGATG 1 cut(s) 376
Cfr13I GGNCC 1 cut(s) 88
CviJI RGCY 2 cut(s) 8, 237
CviKI_1 RGCY 2 cut(s) 8, 237
DdeI CTNAG 1 cut(s) 357
DpnI GATC 3 cut(s) 136, 202, 355
DpnII GATC 3 cut(s) 134, 200, 353
Eco47I GGWCC 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 322
FaiI YATR 2 cut(s) 140, 269
FaqI GGGAC 2 cut(s) 74, 225
FokI GGATG 1 cut(s) 383
HinfI GANTC 2 cut(s) 29, 220
HphI GGTGA 1 cut(s) 287
Hpy188I TCNGA 2 cut(s) 200, 358
Hpy99I CGWCG 1 cut(s) 188
HpyAV CCTTC 3 cut(s) 19, 168, 333
HpyCH4III ACNGT 2 cut(s) 188, 307
HpyF10VI GCNNNNNNNGC 1 cut(s) 333
HpyF3I CTNAG 1 cut(s) 357
Kzo9I GATC 3 cut(s) 134, 200, 353
LpnPI CCDG 3 cut(s) 309, 327, 336
MalI GATC 3 cut(s) 136, 202, 355
MboI GATC 3 cut(s) 134, 200, 353
MflI RGATCY 2 cut(s) 134, 353
MluCI AATT 3 cut(s) 80, 246, 289
MlyI GAGTC 1 cut(s) 214
MmeI TCCRAC 2 cut(s) 57, 112
MnlI CCTC 2 cut(s) 253, 352
MseI TTAA 1 cut(s) 83
MspR9I CCNGG 1 cut(s) 324
MvaI CCWGG 1 cut(s) 324
MvnI CGCG 1 cut(s) 336
MwoI GCNNNNNNNGC 1 cut(s) 333
NdeII GATC 3 cut(s) 134, 200, 353
NlaIV GGNNCC 1 cut(s) 90
NspV TTCGAA 1 cut(s) 23
PfeI GAWTC 1 cut(s) 29
PleI GAGTC 1 cut(s) 214
PpsI GAGTC 1 cut(s) 214
PshBI ATTAAT 1 cut(s) 83
Psp6I CCWGG 1 cut(s) 322
PspGI CCWGG 1 cut(s) 322
PspN4I GGNNCC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 88
PsuI RGATCY 2 cut(s) 134, 353
SaqAI TTAA 1 cut(s) 83
Sau3AI GATC 3 cut(s) 134, 200, 353
Sau96I GGNCC 1 cut(s) 88
SchI GAGTC 1 cut(s) 214
ScrFI CCNGG 1 cut(s) 324
SetI ASST 3 cut(s) 10, 239, 363
SfuI TTCGAA 1 cut(s) 23
SgeI CNNG 9 cut(s) 166, 174, 246, 298, 326, 335, 336, 340, 347
SinI GGWCC 1 cut(s) 88
Sse9I AATT 3 cut(s) 80, 246, 289
SsiI CCGC 1 cut(s) 336
SspI AATATT 1 cut(s) 58
StyD4I CCNGG 1 cut(s) 322
TaaI ACNGT 2 cut(s) 188, 307
TaqI TCGA 2 cut(s) 23, 233
TasI AATT 3 cut(s) 80, 246, 289
TfiI GAWTC 1 cut(s) 29
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 311
TspGWI ACGGA 1 cut(s) 84
VpaK11BI GGWCC 1 cut(s) 88
VspI ATTAAT 1 cut(s) 83
XapI RAATTY 1 cut(s) 289
XcmI CCANNNNNNNNNTGG 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.