Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000675.1

Orthogroup ID

OG0003556

Physical Location & Seq

Genomic Coordinates Reverse (-)

137550 .. 138035

Gene Structure 486 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000675.1_g000034.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 486 bp

atggctctagggcttgatttctcttatccatcatggggtgatgatgttttacttggcaatagtcctaaaccttcatttgtcctgcctcaagttgtttatcaacatggggttcttgaatctctaaccctcttttcttgcaagttcaatgtggccgagataatttttcatctcttgaagcatctttcacttgattggattgaactgcctctaccttcactcactacgttgttagactattgtcaattgctcgaaagcctgagtctaaagaactgctggaacatcactggccttcaaattggtggaaaaaagttgaggctaagaagcttagttattgacaagttcatcatgtccgagaatccttggattgaaatcgaagcatcaaatttgaagtactttaagtattcagggactatggctgtattcgacatccgaacaggagagttggaagaggcataccttgagtttggactttggactcgagtctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0007275 GO:0007276 GO:0008150 GO:0009555 GO:0009987 GO:0019953 GO:0022412 GO:0022414 GO:0030154 GO:0032501 GO:0032502 GO:0032504 GO:0044703 GO:0048229 GO:0048232 GO:0048235 GO:0048609 GO:0048856 GO:0048869 GO:0051704 GO:0055046

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBD

Protein Analysis

161

Amino Acids

18.41

Weight (kDa)

5.14

Isoelectric Point (pI)

47.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003556)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G56400 AT1G56400 AT2G17305 AT3G29830 AT3G29830 AT3G62230 AT5G54820
fragaria_vesca	FvH4_7g19741
malus_domestica	MD03G1208600.v1.1 MD11G1222600.v1.1 MD11G1222800.v1.1 MD11G1223200.v1.1
prunus_persica	Prupe.4G208100_v2.0.a1 Prupe.4G208200_v2.0.a1 Prupe.4G208300_v2.0.a1
pyrus_communis	pycom03g15720 pycom03g15760 pycom11g19660
rosa_chinensis	RchiOBHm_Chr1g0363631 RchiOBHm_Chr7g0214121
rosa_laevigata	RLG00000008357 RLG00000027555
rosa_multiflora	Rmu_sc0000548.1_g000010 Rmu_sc0000675.1_g000034
rosa_roxburghii	Rroxscaffold_4G00293030
rosa_rugosa	Rorug01G0308300
rosa_samantha	Rh1AG089100 Rh1AG317200 Rh1BG280600 Rh1CG296700 Rh1DG311800 Rh4AG168100 Rh4BG165000
rosa_wichuraiana	Rw1G006910 Rw1G028130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	150
AcsI	RAATTY	1 cut(s)	382
AfaI	GTAC	1 cut(s)	392
AfiI	CCNNNNNNNGG	1 cut(s)	35
AgsI	TTSAA	7 cut(s)	116, 145, 175, 200, 293, 368, 388
AluBI	AGCT	1 cut(s)	324
AluI	AGCT	1 cut(s)	324
Ama87I	CYCGRG	1 cut(s)	477
AoxI	GGCC	2 cut(s)	150, 286
ApoI	RAATTY	1 cut(s)	382
AsuHPI	GGTGA	1 cut(s)	50
AvaI	CYCGRG	1 cut(s)	477
BccI	CCATC	1 cut(s)	37
BfaI	CTAG	1 cut(s)	8
BmcAI	AGTACT	1 cut(s)	392
BmeT110I	CYCGRG	1 cut(s)	477
BmsI	GCATC	2 cut(s)	187, 386
BoxI	GACNNNNGTC	2 cut(s)	237, 479
BpuEI	CTTGAG	2 cut(s)	72, 479
BsaBI	GATNNNNATC	1 cut(s)	368
BsaJI	CCNNGG	1 cut(s)	359
Bsc4I	CCNNNNNNNGG	1 cut(s)	35
Bse1I	ACTGG	1 cut(s)	289
Bse8I	GATNNNNATC	1 cut(s)	368
BseDI	CCNNGG	1 cut(s)	359
BseGI	GGATG	1 cut(s)	426
BseJI	GATNNNNATC	1 cut(s)	368
BseLI	CCNNNNNNNGG	1 cut(s)	35
BseMII	CTCAG	1 cut(s)	248
BseNI	ACTGG	1 cut(s)	289
BshFI	GGCC	2 cut(s)	152, 288
BsiHKCI	CYCGRG	1 cut(s)	477
BslFI	GGGAC	1 cut(s)	421
BslI	CCNNNNNNNGG	1 cut(s)	35
BsmFI	GGGAC	1 cut(s)	421
BsnI	GGCC	2 cut(s)	152, 288
BsoBI	CYCGRG	1 cut(s)	477
BspANI	GGCC	2 cut(s)	152, 288
BspCNI	CTCAG	1 cut(s)	249
BsrI	ACTGG	1 cut(s)	289
BssECI	CCNNGG	1 cut(s)	359
BssT1I	CCWWGG	1 cut(s)	359
Bst6I	CTCTTC	1 cut(s)	441
BstDEI	CTNAG	3 cut(s)	257, 317, 325
BstF5I	GGATG	1 cut(s)	426
BstPAI	GACNNNNGTC	2 cut(s)	237, 479
BsuRI	GGCC	2 cut(s)	152, 288
BtsCI	GGATG	1 cut(s)	426
BtsIMutI	CAGTG	1 cut(s)	282
Csp6I	GTAC	1 cut(s)	391
CviAII	CATG	3 cut(s)	33, 104, 346
CviJI	RGCY	8 cut(s)	5, 13, 152, 255, 288, 316, 324, 416
CviKI_1	RGCY	8 cut(s)	5, 13, 152, 255, 288, 316, 324, 416
CviQI	GTAC	1 cut(s)	391
DdeI	CTNAG	3 cut(s)	257, 317, 325
EaeI	YGGCCR	1 cut(s)	150
Eam1104I	CTCTTC	1 cut(s)	441
EarI	CTCTTC	1 cut(s)	441
Eco130I	CCWWGG	1 cut(s)	359
Eco88I	CYCGRG	1 cut(s)	477
EcoT14I	CCWWGG	1 cut(s)	359
ErhI	CCWWGG	1 cut(s)	359
FaeI	CATG	3 cut(s)	36, 107, 349
FaiI	YATR	5 cut(s)	34, 105, 347, 413, 454
FaqI	GGGAC	1 cut(s)	421
FatI	CATG	3 cut(s)	32, 103, 345
FokI	GGATG	1 cut(s)	413
FspBI	CTAG	1 cut(s)	8
HaeIII	GGCC	2 cut(s)	152, 288
Hin1II	CATG	3 cut(s)	36, 107, 349
HindIII	AAGCTT	1 cut(s)	322
HinfI	GANTC	5 cut(s)	116, 259, 355, 475, 480
HphI	GGTGA	1 cut(s)	50
Hpy188I	TCNGA	3 cut(s)	352, 431, 485
Hpy188III	TCNNGA	2 cut(s)	113, 172
HpyAV	CCTTC	3 cut(s)	81, 222, 299
HpyCH4IV	ACGT	1 cut(s)	224
HpyCH4V	TGCA	1 cut(s)	138
HpyF3I	CTNAG	3 cut(s)	257, 317, 325
HpySE526I	ACGT	1 cut(s)	224
Hsp92II	CATG	3 cut(s)	36, 107, 349
LpnPI	CCDG	6 cut(s)	95, 259, 269, 270, 390, 420
LweI	GCATC	2 cut(s)	187, 386
MaeI	CTAG	1 cut(s)	8
MaeII	ACGT	1 cut(s)	224
MboII	GAAGA	1 cut(s)	458
MfeI	CAATTG	1 cut(s)	242
MluCI	AATT	4 cut(s)	159, 242, 294, 382
MlyI	GAGTC	2 cut(s)	268, 469
MmeI	TCCRAC	1 cut(s)	423
MnlI	CCTC	5 cut(s)	96, 137, 216, 306, 442
MseI	TTAA	1 cut(s)	396
MunI	CAATTG	1 cut(s)	242
NlaIII	CATG	3 cut(s)	36, 107, 349
NmeAIII	GCCGAG	1 cut(s)	178
PaeR7I	CTCGAG	1 cut(s)	477
PfeI	GAWTC	2 cut(s)	116, 355
PleI	GAGTC	2 cut(s)	267, 469
PpsI	GAGTC	2 cut(s)	267, 469
PshAI	GACNNNNGTC	2 cut(s)	237, 479
PspXI	VCTCGAGB	1 cut(s)	477
PsrI	GAACNNNNNNTAC	2 cut(s)	192, 224
RsaI	GTAC	1 cut(s)	392
RsaNI	GTAC	1 cut(s)	391
SaqAI	TTAA	1 cut(s)	396
ScaI	AGTACT	1 cut(s)	392
SchI	GAGTC	2 cut(s)	268, 469
SetI	ASST	5 cut(s)	73, 214, 227, 326, 459
SfaNI	GCATC	2 cut(s)	187, 386
Sfr274I	CTCGAG	1 cut(s)	477
SlaI	CTCGAG	1 cut(s)	477
SmlI	CTYRAG	3 cut(s)	87, 458, 477
SmoI	CTYRAG	3 cut(s)	87, 458, 477
Sse9I	AATT	4 cut(s)	159, 242, 294, 382
SspMI	CTAG	1 cut(s)	8
StyI	CCWWGG	1 cut(s)	359
TaiI	ACGT	1 cut(s)	227
TaqI	TCGA	4 cut(s)	249, 372, 423, 478
TasI	AATT	4 cut(s)	159, 242, 294, 382
TatI	WGTACW	1 cut(s)	390
TfiI	GAWTC	2 cut(s)	116, 355
Tru1I	TTAA	1 cut(s)	396
Tru9I	TTAA	1 cut(s)	396
TscAI	CASTG	1 cut(s)	289
TspDTI	ATGAA	3 cut(s)	63, 155, 331
TspRI	CASTG	1 cut(s)	289
XapI	RAATTY	1 cut(s)	382
XhoI	CTCGAG	1 cut(s)	477
XspI	CTAG	1 cut(s)	8
ZrmI	AGTACT	1 cut(s)	392

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.