Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001070.1

Orthogroup ID

OG0004841

Physical Location & Seq

Genomic Coordinates Forward (+)

124147 .. 124488

Gene Structure 342 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001070.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 342 bp

atgagttatcgggatgttatttgtgacatgtcggtttctcattggctcggggtcgcggcgctgtgggacccctctctcgggtcaccacaaaagaggttactaatttctgcatcttctattcccttgcaggcgttaacacataattctgcaacgtatagatttaatgatgcagagaggatggcggctcaatttgaacaacagttagaccgtgctaaaggaggaaaacgaaaagtgactagtagacaggaaatggcagttcggtgtctgattgggacgcaccttacctttccggaaagggaatcgcgccagaaacaagactcatggtcaaaccatgagctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

113

Amino Acids

12.87

Weight (kDa)

9.14

Isoelectric Point (pI)

62.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004841)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g06290 FvH4_2g06290 FvH4_2g06290
rosa_chinensis	RchiOBHm_Chr6g0256801 RchiOBHm_Chr7g0241311
rosa_laevigata	RLG00000014644
rosa_multiflora	Rmu_sc0000857.1_g000026 Rmu_sc0001070.1_g000027 Rmu_sc0001256.1_g000010 Rmu_sc0003076.1_g000019 Rmu_sc0004277.1_g000042 Rmu_sc0006763.1_g000019 Rmu_sc0007548.1_g000009 Rmu_sc0007633.1_g000016 Rmu_sc0009227.1_g000008 Rmu_sc0009719.1_g000005 Rmu_sc0014303.1_g000002 Rmu_sc0017785.1_g000012
rosa_roxburghii	Rroxscaffold_1G00028540 Rroxscaffold_2G00109820 Rroxscaffold_7G00208170 Rroxscaffold_7G00208180
rosa_rugosa	Rorug05G0577900
rosa_samantha	Rh2AG393100 Rh2BG377300 Rh2CG379800 Rh2DG415700 Rh6AG096300 Rh6BG087500 Rh6CG083400 Rh6DG079200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	241
AccII	CGCG	2 cut(s)	56, 304
AccIII	TCCGGA	1 cut(s)	289
AciI	CCGC	2 cut(s)	56, 182
AfiI	CCNNNNNNNGG	2 cut(s)	77, 78
AflIII	ACRYGT	1 cut(s)	27
AgsI	TTSAA	1 cut(s)	194
AhdI	GACNNNNNGTC	1 cut(s)	322
AhlI	ACTAGT	1 cut(s)	236
AluBI	AGCT	1 cut(s)	337
AluI	AGCT	1 cut(s)	337
Ama87I	CYCGRG	2 cut(s)	47, 77
Aor13HI	TCCGGA	1 cut(s)	289
AspLEI	GCGC	2 cut(s)	61, 306
AspS9I	GGNCC	1 cut(s)	67
AsuHPI	GGTGA	1 cut(s)	75
AvaI	CYCGRG	2 cut(s)	47, 77
AvaII	GGWCC	1 cut(s)	67
BccI	CCATC	1 cut(s)	172
BcuI	ACTAGT	1 cut(s)	236
BfaI	CTAG	1 cut(s)	237
BfmI	CTRYAG	1 cut(s)	338
BfoI	RGCGCY	1 cut(s)	62
BisI	GCNGC	2 cut(s)	57, 183
BlsI	GCNGC	2 cut(s)	58, 184
Bme18I	GGWCC	1 cut(s)	67
BmeRI	GACNNNNNGTC	1 cut(s)	322
BmeT110I	CYCGRG	2 cut(s)	47, 77
BmgT120I	GGNCC	1 cut(s)	67
BmiI	GGNNCC	2 cut(s)	68, 69
BmsI	GCATC	2 cut(s)	119, 157
BsaWI	WCCGGW	1 cut(s)	289
Bsc4I	CCNNNNNNNGG	2 cut(s)	77, 78
BseAI	TCCGGA	1 cut(s)	289
BseGI	GGATG	2 cut(s)	19, 183
BseLI	CCNNNNNNNGG	2 cut(s)	77, 78
Bsh1236I	CGCG	2 cut(s)	56, 304
BsiHKCI	CYCGRG	2 cut(s)	47, 77
BsiSI	CCGG	1 cut(s)	290
BslFI	GGGAC	2 cut(s)	80, 286
BslI	CCNNNNNNNGG	2 cut(s)	77, 78
BsmFI	GGGAC	2 cut(s)	80, 286
BsoBI	CYCGRG	2 cut(s)	47, 77
Bsp13I	TCCGGA	1 cut(s)	289
BspACI	CCGC	2 cut(s)	56, 182
BspEI	TCCGGA	1 cut(s)	289
BspFNI	CGCG	2 cut(s)	56, 304
BspLI	GGNNCC	2 cut(s)	68, 69
Bst4CI	ACNGT	2 cut(s)	201, 209
BstC8I	GCNNGC	1 cut(s)	129
BstEII	GGTNACC	1 cut(s)	81
BstF5I	GGATG	2 cut(s)	19, 183
BstFNI	CGCG	2 cut(s)	56, 304
BstH2I	RGCGCY	1 cut(s)	62
BstHHI	GCGC	2 cut(s)	61, 306
BstNSI	RCATGY	1 cut(s)	31
BstPI	GGTNACC	1 cut(s)	81
BstSFI	CTRYAG	1 cut(s)	338
BstUI	CGCG	2 cut(s)	56, 304
BtsCI	GGATG	2 cut(s)	19, 183
Cac8I	GCNNGC	1 cut(s)	129
CfoI	GCGC	2 cut(s)	61, 306
Cfr13I	GGNCC	1 cut(s)	67
CseI	GACGC	1 cut(s)	283
CviAII	CATG	3 cut(s)	28, 321, 332
CviJI	RGCY	3 cut(s)	46, 185, 337
CviKI_1	RGCY	3 cut(s)	46, 185, 337
DriI	GACNNNNNGTC	1 cut(s)	322
Eam1105I	GACNNNNNGTC	1 cut(s)	322
Eco47I	GGWCC	1 cut(s)	67
Eco88I	CYCGRG	2 cut(s)	47, 77
Eco91I	GGTNACC	1 cut(s)	81
EcoO109I	RGGNCCY	1 cut(s)	67
EcoO65I	GGTNACC	1 cut(s)	81
FaeI	CATG	3 cut(s)	31, 324, 335
FaiI	YATR	5 cut(s)	29, 141, 156, 322, 333
FaqI	GGGAC	2 cut(s)	80, 286
FatI	CATG	3 cut(s)	27, 320, 331
FblI	GTMKAC	1 cut(s)	241
Fnu4HI	GCNGC	2 cut(s)	57, 183
FokI	GGATG	2 cut(s)	26, 190
Fsp4HI	GCNGC	2 cut(s)	57, 183
FspBI	CTAG	1 cut(s)	237
GlaI	GCGC	2 cut(s)	60, 305
GluI	GCNGC	2 cut(s)	57, 183
HaeII	RGCGCY	1 cut(s)	62
HapII	CCGG	1 cut(s)	290
HgaI	GACGC	1 cut(s)	283
HhaI	GCGC	2 cut(s)	61, 306
Hin1II	CATG	3 cut(s)	31, 324, 335
Hin6I	GCGC	2 cut(s)	59, 304
HinP1I	GCGC	2 cut(s)	59, 304
HincII	GTYRAC	1 cut(s)	135
HindII	GTYRAC	1 cut(s)	135
HinfI	GANTC	2 cut(s)	299, 317
HpaI	GTTAAC	1 cut(s)	135
HpaII	CCGG	1 cut(s)	290
HphI	GGTGA	1 cut(s)	75
Hpy166II	GTNNAC	2 cut(s)	135, 242
Hpy188I	TCNGA	1 cut(s)	267
Hpy188III	TCNNGA	2 cut(s)	11, 290
Hpy8I	GTNNAC	2 cut(s)	135, 242
HpyCH4III	ACNGT	2 cut(s)	201, 209
HpyCH4IV	ACGT	1 cut(s)	152
HpyCH4V	TGCA	4 cut(s)	110, 127, 149, 170
HpySE526I	ACGT	1 cut(s)	152
Hsp92II	CATG	3 cut(s)	31, 324, 335
HspAI	GCGC	2 cut(s)	59, 304
KflI	GGGWCCC	1 cut(s)	67
Kpn2I	TCCGGA	1 cut(s)	289
KspAI	GTTAAC	1 cut(s)	135
LpnPI	CCDG	4 cut(s)	113, 230, 303, 320
LweI	GCATC	2 cut(s)	119, 157
MaeI	CTAG	1 cut(s)	237
MaeII	ACGT	1 cut(s)	152
MaeIII	GTNAC	4 cut(s)	23, 81, 96, 232
MboII	GAAGA	1 cut(s)	105
MluCI	AATT	3 cut(s)	102, 142, 188
MlyI	GAGTC	1 cut(s)	311
MnlI	CCTC	4 cut(s)	82, 87, 168, 212
MroI	TCCGGA	1 cut(s)	289
MseI	TTAA	2 cut(s)	134, 162
MspI	CCGG	1 cut(s)	290
MvnI	CGCG	2 cut(s)	56, 304
NlaIII	CATG	3 cut(s)	31, 324, 335
NlaIV	GGNNCC	2 cut(s)	68, 69
NmuCI	GTSAC	3 cut(s)	23, 81, 232
NspI	RCATGY	1 cut(s)	31
PciI	ACATGT	1 cut(s)	27
PfeI	GAWTC	1 cut(s)	299
PkrI	GCNGC	2 cut(s)	58, 184
PleI	GAGTC	1 cut(s)	311
PpsI	GAGTC	1 cut(s)	311
PpuMI	RGGWCCY	1 cut(s)	67
PscI	ACATGT	1 cut(s)	27
Psp5II	RGGWCCY	1 cut(s)	67
PspEI	GGTNACC	1 cut(s)	81
PspN4I	GGNNCC	2 cut(s)	68, 69
PspPI	GGNCC	1 cut(s)	67
PspPPI	RGGWCCY	1 cut(s)	67
SaqAI	TTAA	2 cut(s)	134, 162
SatI	GCNGC	2 cut(s)	57, 183
Sau96I	GGNCC	1 cut(s)	67
SchI	GAGTC	1 cut(s)	311
SetI	ASST	5 cut(s)	98, 155, 282, 287, 339
SfaNI	GCATC	2 cut(s)	119, 157
SfcI	CTRYAG	1 cut(s)	338
SinI	GGWCC	1 cut(s)	67
SpeI	ACTAGT	1 cut(s)	236
Sse9I	AATT	3 cut(s)	102, 142, 188
SsiI	CCGC	2 cut(s)	56, 182
SspMI	CTAG	1 cut(s)	237
TaaI	ACNGT	2 cut(s)	201, 209
TaiI	ACGT	1 cut(s)	155
TasI	AATT	3 cut(s)	102, 142, 188
TauI	GCSGC	2 cut(s)	59, 185
TfiI	GAWTC	1 cut(s)	299
Tru1I	TTAA	2 cut(s)	134, 162
Tru9I	TTAA	2 cut(s)	134, 162
TseFI	GTSAC	3 cut(s)	23, 81, 232
Tsp45I	GTSAC	3 cut(s)	23, 81, 232
VpaK11BI	GGWCC	1 cut(s)	67
XceI	RCATGY	1 cut(s)	31
XmiI	GTMKAC	1 cut(s)	241
XspI	CTAG	1 cut(s)	237

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.