Rmu_sc0004277.1_g000042

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004277.1
OG0004841
Physical Location & Seq
Forward (+)
150858 .. 151199
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004277.1_g000042.1.cds

Sequence Viewer

Length: 342 bp
atgaagttgaaacgggtaatggaagaactattaaaaggaaatcaagaagcacagtcatgtttgaggtatgaacctggtgacttctgtgaagctatatgctcaatctccattttcacctttagacatacatttcttaatactgaattttattttctgtatgacatcaggatccgagatgatgcagaacggatggcagcccaatttgaagaacagttagatcgtgctaaaggaggaaaacaaaaagtgactagtagacaggaaacagctcggtgtccgattgggacgtgccttacctttccggaaagggaatcgcaccagaaacaagaaagccatgagctgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

13.3

Weight (kDa)

5.94

Isoelectric Point (pI)

55.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 253
AccIII TCCGGA 1 cut(s) 298
AclWI GGATC 2 cut(s) 163, 176
AcsI RAATTY 1 cut(s) 143
AgsI TTSAA 2 cut(s) 10, 206
AhlI ACTAGT 1 cut(s) 248
AjiI CACGTC 1 cut(s) 285
AjnI CCWGG 1 cut(s) 73
AluBI AGCT 3 cut(s) 92, 266, 337
AluI AGCT 3 cut(s) 92, 266, 337
AlwI GGATC 2 cut(s) 163, 176
Aor13HI TCCGGA 1 cut(s) 298
ApeKI GCWGC 1 cut(s) 194
ApoI RAATTY 1 cut(s) 143
AsuHPI GGTGA 2 cut(s) 89, 106
BamHI GGATCC 1 cut(s) 168
BbvI GCAGC 1 cut(s) 206
BccI CCATC 1 cut(s) 184
BciT130I CCWGG 1 cut(s) 75
BcuI ACTAGT 1 cut(s) 248
BfaI CTAG 1 cut(s) 249
BfmI CTRYAG 1 cut(s) 338
BisI GCNGC 1 cut(s) 195
BlsI GCNGC 1 cut(s) 196
Bme1390I CCNGG 1 cut(s) 75
BmgBI CACGTC 1 cut(s) 285
BmiI GGNNCC 1 cut(s) 170
BmrFI CCNGG 1 cut(s) 75
BmsI GCATC 1 cut(s) 169
BsaWI WCCGGW 1 cut(s) 298
BseAI TCCGGA 1 cut(s) 298
BseBI CCWGG 1 cut(s) 75
BseGI GGATG 1 cut(s) 195
BseXI GCAGC 1 cut(s) 206
BsiSI CCGG 1 cut(s) 299
BslFI GGGAC 1 cut(s) 295
BsmFI GGGAC 1 cut(s) 295
Bsp13I TCCGGA 1 cut(s) 298
Bsp143I GATC 2 cut(s) 168, 217
BspEI TCCGGA 1 cut(s) 298
BspLI GGNNCC 1 cut(s) 170
BspPI GGATC 2 cut(s) 163, 176
BssMI GATC 2 cut(s) 168, 217
Bst2UI CCWGG 1 cut(s) 75
Bst4CI ACNGT 2 cut(s) 54, 213
BstF5I GGATG 1 cut(s) 195
BstKTI GATC 2 cut(s) 171, 220
BstMBI GATC 2 cut(s) 168, 217
BstNI CCWGG 1 cut(s) 75
BstSCI CCNGG 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 338
BstV1I GCAGC 1 cut(s) 206
BstX2I RGATCY 1 cut(s) 168
BstYI RGATCY 1 cut(s) 168
BtrI CACGTC 1 cut(s) 285
BtsCI GGATG 1 cut(s) 195
CsiI ACCWGGT 1 cut(s) 73
CviAII CATG 2 cut(s) 57, 332
CviJI RGCY 5 cut(s) 92, 197, 266, 330, 337
CviKI_1 RGCY 5 cut(s) 92, 197, 266, 330, 337
DpnI GATC 2 cut(s) 170, 219
DpnII GATC 2 cut(s) 168, 217
EcoRII CCWGG 1 cut(s) 73
FaeI CATG 2 cut(s) 60, 335
FaiI YATR 7 cut(s) 58, 69, 95, 97, 126, 159, 333
FaqI GGGAC 1 cut(s) 295
FatI CATG 2 cut(s) 56, 331
FblI GTMKAC 1 cut(s) 253
Fnu4HI GCNGC 1 cut(s) 195
FokI GGATG 1 cut(s) 202
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 1 cut(s) 249
GluI GCNGC 1 cut(s) 195
HapII CCGG 1 cut(s) 299
Hin1II CATG 2 cut(s) 60, 335
HinfI GANTC 1 cut(s) 308
HpaII CCGG 1 cut(s) 299
HphI GGTGA 2 cut(s) 89, 106
Hpy166II GTNNAC 1 cut(s) 254
Hpy188I TCNGA 2 cut(s) 173, 276
Hpy188III TCNNGA 3 cut(s) 44, 166, 299
Hpy8I GTNNAC 1 cut(s) 254
HpyCH4III ACNGT 2 cut(s) 54, 213
HpyCH4IV ACGT 1 cut(s) 284
HpyCH4V TGCA 1 cut(s) 182
HpySE526I ACGT 1 cut(s) 284
Hsp92II CATG 2 cut(s) 60, 335
Kpn2I TCCGGA 1 cut(s) 298
Kzo9I GATC 2 cut(s) 168, 217
LpnPI CCDG 6 cut(s) 60, 87, 151, 242, 312, 329
Lsp1109I GCAGC 1 cut(s) 206
LweI GCATC 1 cut(s) 169
MabI ACCWGGT 1 cut(s) 73
MaeI CTAG 1 cut(s) 249
MaeII ACGT 1 cut(s) 284
MaeIII GTNAC 2 cut(s) 77, 244
MalI GATC 2 cut(s) 170, 219
MboI GATC 2 cut(s) 168, 217
MboII GAAGA 2 cut(s) 35, 218
MflI RGATCY 1 cut(s) 168
MluCI AATT 2 cut(s) 143, 200
MnlI CCTC 2 cut(s) 57, 224
MroI TCCGGA 1 cut(s) 298
MseI TTAA 2 cut(s) 32, 135
MslI CAYNNNNRTG 1 cut(s) 55
MspI CCGG 1 cut(s) 299
MspR9I CCNGG 1 cut(s) 75
MvaI CCWGG 1 cut(s) 75
NdeII GATC 2 cut(s) 168, 217
NlaIII CATG 2 cut(s) 60, 335
NlaIV GGNNCC 1 cut(s) 170
NmuCI GTSAC 2 cut(s) 77, 244
PfeI GAWTC 1 cut(s) 308
PkrI GCNGC 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PspN4I GGNNCC 1 cut(s) 170
PsuI RGATCY 1 cut(s) 168
RseI CAYNNNNRTG 1 cut(s) 55
SaqAI TTAA 2 cut(s) 32, 135
SatI GCNGC 1 cut(s) 195
Sau3AI GATC 2 cut(s) 168, 217
ScrFI CCNGG 1 cut(s) 75
SetI ASST 8 cut(s) 68, 76, 94, 119, 268, 287, 296, 339
SexAI ACCWGGT 1 cut(s) 73
SfaNI GCATC 1 cut(s) 169
SfcI CTRYAG 1 cut(s) 338
SmiMI CAYNNNNRTG 1 cut(s) 55
SpeI ACTAGT 1 cut(s) 248
Sse9I AATT 2 cut(s) 143, 200
SspMI CTAG 1 cut(s) 249
StyD4I CCNGG 1 cut(s) 73
TaaI ACNGT 2 cut(s) 54, 213
TaiI ACGT 1 cut(s) 287
TasI AATT 2 cut(s) 143, 200
TfiI GAWTC 1 cut(s) 308
Tru1I TTAA 2 cut(s) 32, 135
Tru9I TTAA 2 cut(s) 32, 135
TseFI GTSAC 2 cut(s) 77, 244
TseI GCWGC 1 cut(s) 194
Tsp45I GTSAC 2 cut(s) 77, 244
TspDTI ATGAA 2 cut(s) 17, 84
TspGWI ACGGA 1 cut(s) 202
XapI RAATTY 1 cut(s) 143
XmiI GTMKAC 1 cut(s) 253
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.