Rmu_sc0001501.1_g000097

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001501.1
Physical Location & Seq
Reverse (-)
402667 .. 403014
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001501.1_g000097.1.cds

Sequence Viewer

Length: 348 bp
atggcaggaagcttgagggatgcaatctggtgtgatcttgatttggatgaggataggctcacctgcaggggatggctgtgtggactggttttggcgacgggatgcgtctggttcggctggtcgaggtgtgctgatggagcagtcttcccgtgtgctacggagacggtgacttcggtggatatcaggggcggcttcgacggcgttttggctcgtggtgctggtgcttggctcgtcgtcagggttttgggctggtcatggtggatgggtttggtgtttgggctttgtccttgggctaagtcatgtggtcatgtaggctggtcttttgcctattctagtatatttctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.54

Weight (kDa)

5.07

Isoelectric Point (pI)

25.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 71
Acc36I ACCTGC 1 cut(s) 71
AciI CCGC 1 cut(s) 189
AluBI AGCT 1 cut(s) 12
AluI AGCT 1 cut(s) 12
Alw26I GTCTC 1 cut(s) 155
ArsI GACNNNNNNTTYG 2 cut(s) 154, 186
AsuHPI GGTGA 2 cut(s) 52, 178
BauI CACGAG 1 cut(s) 210
BbsI GAAGAC 1 cut(s) 136
BccI CCATC 3 cut(s) 66, 128, 256
BceAI ACGGC 1 cut(s) 214
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 2 cut(s) 333, 346
BfmI CTRYAG 1 cut(s) 64
BfuAI ACCTGC 1 cut(s) 71
BisI GCNGC 1 cut(s) 190
BlsI GCNGC 1 cut(s) 191
BmsI GCATC 2 cut(s) 10, 92
BpiI GAAGAC 1 cut(s) 136
BpuEI CTTGAG 1 cut(s) 34
BsaJI CCNNGG 1 cut(s) 287
Bse1I ACTGG 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 287
BseGI GGATG 5 cut(s) 25, 52, 77, 107, 267
BseNI ACTGG 1 cut(s) 90
BsmAI GTCTC 1 cut(s) 155
BsmBI CGTCTC 1 cut(s) 155
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 1 cut(s) 189
BspMAI CTGCAG 1 cut(s) 68
BspMI ACCTGC 1 cut(s) 71
BsrI ACTGG 1 cut(s) 90
BssECI CCNNGG 1 cut(s) 287
BssMI GATC 1 cut(s) 34
BssSI CACGAG 1 cut(s) 210
BssT1I CCWWGG 1 cut(s) 287
Bst2BI CACGAG 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 5 cut(s) 25, 52, 77, 107, 267
BstKTI GATC 1 cut(s) 37
BstMAI GTCTC 1 cut(s) 155
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 3 cut(s) 137, 198, 215
BstSFI CTRYAG 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 136
BtsCI GGATG 5 cut(s) 25, 52, 77, 107, 267
BveI ACCTGC 1 cut(s) 71
CseI GACGC 1 cut(s) 94
CviAII CATG 3 cut(s) 255, 300, 308
DdeI CTNAG 1 cut(s) 294
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco130I CCWWGG 1 cut(s) 287
Eco32I GATATC 1 cut(s) 181
EcoRV GATATC 1 cut(s) 181
EcoT14I CCWWGG 1 cut(s) 287
ErhI CCWWGG 1 cut(s) 287
Esp3I CGTCTC 1 cut(s) 155
FaeI CATG 3 cut(s) 258, 303, 311
FaiI YATR 4 cut(s) 256, 301, 309, 338
FatI CATG 3 cut(s) 254, 299, 307
Fnu4HI GCNGC 1 cut(s) 190
FokI GGATG 5 cut(s) 32, 59, 84, 114, 274
Fsp4HI GCNGC 1 cut(s) 190
FspBI CTAG 2 cut(s) 333, 346
GluI GCNGC 1 cut(s) 190
HgaI GACGC 1 cut(s) 94
Hin1II CATG 3 cut(s) 258, 303, 311
HindIII AAGCTT 1 cut(s) 10
HphI GGTGA 2 cut(s) 52, 178
Hpy166II GTNNAC 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 83
Hpy99I CGWCG 3 cut(s) 100, 200, 236
HpyCH4III ACNGT 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 23, 66
HpyF10VI GCNNNNNNNGC 3 cut(s) 137, 198, 215
HpyF3I CTNAG 1 cut(s) 294
Hsp92II CATG 3 cut(s) 258, 303, 311
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 137
LweI GCATC 2 cut(s) 10, 92
MaeI CTAG 2 cut(s) 333, 346
MaeIII GTNAC 1 cut(s) 166
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 1 cut(s) 136
MnlI CCTC 3 cut(s) 9, 43, 117
MwoI GCNNNNNNNGC 3 cut(s) 137, 198, 215
NdeII GATC 1 cut(s) 34
NlaIII CATG 3 cut(s) 258, 303, 311
NmuCI GTSAC 1 cut(s) 166
PaqCI CACCTGC 1 cut(s) 71
PkrI GCNGC 1 cut(s) 191
PstI CTGCAG 1 cut(s) 68
SatI GCNGC 1 cut(s) 190
Sau3AI GATC 1 cut(s) 34
SbfI CCTGCAGG 1 cut(s) 68
SdaI CCTGCAGG 1 cut(s) 68
SetI ASST 3 cut(s) 14, 65, 128
SfaNI GCATC 2 cut(s) 10, 92
SfcI CTRYAG 1 cut(s) 64
SmlI CTYRAG 1 cut(s) 13
SmoI CTYRAG 1 cut(s) 13
Sse8387I CCTGCAGG 1 cut(s) 68
SsiI CCGC 1 cut(s) 189
SspMI CTAG 2 cut(s) 333, 346
StyI CCWWGG 1 cut(s) 287
TaaI ACNGT 1 cut(s) 166
TaqI TCGA 2 cut(s) 122, 195
TauI GCSGC 1 cut(s) 192
TseFI GTSAC 1 cut(s) 166
Tsp45I GTSAC 1 cut(s) 166
TspGWI ACGGA 1 cut(s) 173
XspI CTAG 2 cut(s) 333, 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.