Rmu_sc0001512.1_g000015

U3 small nucleolar ribonucleoprotein protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001512.1
Physical Location & Seq
Forward (+)
75413 .. 77964
2552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001512.1_g000015.1.cds

Sequence Viewer

Length: 438 bp
atgcaggttatttctgaaattgttgaaagttgccgtgcacatgactacacagatgttgtgttggtgcatgaacatcgtggtaaacttgatggtttgattgtatgccaccttccatatggaccaacagcttattttcaactatgcaatgtggtttcaagacatgacatcaaggacaagaaagccatgggaacggtgccacaggcttatccacatttgataattaacaatttcacgactaagttgggtgagcggactgcaaatattttaaaacatctttttccagtgccaaagccagatacaaaacgcataatcactttttcgaatgagcaggactacatttcattcagtctagaaagcccatttgtgagggcaacttggcaaggccggaaaggtggcttcccggcgacggatttgcgacttccggataccgtagcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

145

Amino Acids

16.4

Weight (kDa)

8.46

Isoelectric Point (pI)

35.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 193
AccBSI CCGCTC 1 cut(s) 250
AccIII TCCGGA 1 cut(s) 421
AciI CCGC 1 cut(s) 250
AfiI CCNNNNNNNGG 1 cut(s) 406
AgsI TTSAA 3 cut(s) 26, 137, 156
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw21I GWGCWC 1 cut(s) 40
Alw44I GTGCAC 1 cut(s) 36
Aor13HI TCCGGA 1 cut(s) 421
AoxI GGCC 1 cut(s) 382
ApaLI GTGCAC 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 119
AsuC2I CCSGG 1 cut(s) 401
AsuHPI GGTGA 1 cut(s) 257
AsuII TTCGAA 1 cut(s) 320
AvaII GGWCC 1 cut(s) 119
BaeGI GKGCMC 1 cut(s) 40
BanI GGYRCC 1 cut(s) 193
BarI GAAGNNNNNNTAC 2 cut(s) 93, 125
Bbv12I GWGCWC 1 cut(s) 40
BccI CCATC 1 cut(s) 83
BceAI ACGGC 1 cut(s) 18
BcgI CGANNNNNNTGC 4 cut(s) 56, 90, 394, 428
BciVI GTATCC 1 cut(s) 418
BcnI CCSGG 1 cut(s) 401
BfaI CTAG 1 cut(s) 350
BfuI GTATCC 1 cut(s) 418
Bme1390I CCNGG 1 cut(s) 401
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 401
Bpu14I TTCGAA 1 cut(s) 320
BpuMI CCSGG 1 cut(s) 401
BsaJI CCNNGG 1 cut(s) 183
BsaWI WCCGGW 1 cut(s) 421
Bsc4I CCNNNNNNNGG 1 cut(s) 406
Bse1I ACTGG 1 cut(s) 281
Bse3DI GCAATG 1 cut(s) 151
BseAI TCCGGA 1 cut(s) 421
BseDI CCNNGG 1 cut(s) 183
BseLI CCNNNNNNNGG 1 cut(s) 406
BseMI GCAATG 1 cut(s) 151
BseNI ACTGG 1 cut(s) 281
BseSI GKGCMC 1 cut(s) 40
BshFI GGCC 1 cut(s) 384
BshNI GGYRCC 1 cut(s) 193
BsiHKAI GWGCWC 1 cut(s) 40
BsiSI CCGG 3 cut(s) 385, 401, 422
BslI CCNNNNNNNGG 1 cut(s) 406
BsnI GGCC 1 cut(s) 384
Bsp119I TTCGAA 1 cut(s) 320
Bsp1286I GDGCHC 1 cut(s) 40
Bsp13I TCCGGA 1 cut(s) 421
Bsp19I CCATGG 1 cut(s) 183
BspACI CCGC 1 cut(s) 250
BspANI GGCC 1 cut(s) 384
BspEI TCCGGA 1 cut(s) 421
BspLI GGNNCC 1 cut(s) 195
BspT104I TTCGAA 1 cut(s) 320
BspT107I GGYRCC 1 cut(s) 193
BsrBI CCGCTC 1 cut(s) 250
BsrDI GCAATG 1 cut(s) 151
BsrI ACTGG 1 cut(s) 281
BssECI CCNNGG 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 183
Bst4CI ACNGT 2 cut(s) 193, 430
BstBI TTCGAA 1 cut(s) 320
BstDEI CTNAG 1 cut(s) 237
BstDSI CCRYGG 1 cut(s) 183
BstSCI CCNGG 1 cut(s) 399
BstSLI GKGCMC 1 cut(s) 40
BsuI GTATCC 1 cut(s) 418
BsuRI GGCC 1 cut(s) 384
BtgI CCRYGG 1 cut(s) 183
BtsIMutI CAGTG 1 cut(s) 288
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 4 cut(s) 41, 68, 161, 184
CviJI RGCY 7 cut(s) 128, 182, 203, 292, 357, 384, 396
CviKI_1 RGCY 7 cut(s) 128, 182, 203, 292, 357, 384, 396
DdeI CTNAG 1 cut(s) 237
DraI TTTAAA 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 183
Eco47I GGWCC 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 183
ErhI CCWWGG 1 cut(s) 183
FaeI CATG 4 cut(s) 44, 71, 164, 187
FaiI YATR 9 cut(s) 42, 69, 103, 115, 117, 142, 162, 185, 308
FatI CATG 4 cut(s) 40, 67, 160, 183
FauNDI CATATG 1 cut(s) 115
FspBI CTAG 1 cut(s) 350
HaeIII GGCC 1 cut(s) 384
HapII CCGG 3 cut(s) 385, 401, 422
Hin1II CATG 4 cut(s) 44, 71, 164, 187
HpaII CCGG 3 cut(s) 385, 401, 422
HphI GGTGA 1 cut(s) 257
Hpy166II GTNNAC 2 cut(s) 38, 83
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 4 cut(s) 156, 232, 350, 422
Hpy8I GTNNAC 2 cut(s) 38, 83
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 1 cut(s) 119
HpyCH4III ACNGT 2 cut(s) 193, 430
HpyCH4V TGCA 5 cut(s) 4, 38, 67, 144, 257
HpyF3I CTNAG 1 cut(s) 237
Hsp92II CATG 4 cut(s) 44, 71, 164, 187
Kpn2I TCCGGA 1 cut(s) 421
LpnPI CCDG 6 cut(s) 185, 294, 306, 314, 398, 414
MaeI CTAG 1 cut(s) 350
MbiI CCGCTC 1 cut(s) 250
MhlI GDGCHC 1 cut(s) 40
MluCI AATT 3 cut(s) 18, 219, 226
MnlI CCTC 1 cut(s) 360
MroI TCCGGA 1 cut(s) 421
MseI TTAA 2 cut(s) 222, 266
MspI CCGG 3 cut(s) 385, 401, 422
MspR9I CCNGG 1 cut(s) 401
NciI CCSGG 1 cut(s) 401
NcoI CCATGG 1 cut(s) 183
NdeI CATATG 1 cut(s) 115
NlaIII CATG 4 cut(s) 44, 71, 164, 187
NlaIV GGNNCC 1 cut(s) 195
NspV TTCGAA 1 cut(s) 320
PspN4I GGNNCC 1 cut(s) 195
PspPI GGNCC 1 cut(s) 119
SaqAI TTAA 2 cut(s) 222, 266
Sau96I GGNCC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 401
SduI GDGCHC 1 cut(s) 40
SetI ASST 4 cut(s) 9, 111, 130, 394
SfuI TTCGAA 1 cut(s) 320
SinI GGWCC 1 cut(s) 119
Sse9I AATT 3 cut(s) 18, 219, 226
SsiI CCGC 1 cut(s) 250
SspI AATATT 1 cut(s) 262
SspMI CTAG 1 cut(s) 350
StyD4I CCNGG 1 cut(s) 399
StyI CCWWGG 1 cut(s) 183
TaaI ACNGT 2 cut(s) 193, 430
TaqI TCGA 1 cut(s) 320
TasI AATT 3 cut(s) 18, 219, 226
Tru1I TTAA 2 cut(s) 222, 266
Tru9I TTAA 2 cut(s) 222, 266
TscAI CASTG 1 cut(s) 288
TspDTI ATGAA 2 cut(s) 84, 330
TspGWI ACGGA 1 cut(s) 422
TspRI CASTG 1 cut(s) 288
VneI GTGCAC 1 cut(s) 36
VpaK11BI GGWCC 1 cut(s) 119
XbaI TCTAGA 1 cut(s) 349
XcmI CCANNNNNNNNNTGG 1 cut(s) 113
XspI CTAG 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.