Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001527.1

Orthogroup ID

OG0002887

Physical Location & Seq

Genomic Coordinates Reverse (-)

172314 .. 174193

Gene Structure 1880 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001527.1_g000034.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 471 bp

atggaggaaaccaaaatatgtatggatcttcatctgaattttgattggaaattcagaatcagtggagaagatgatacgagtggtgatggtgatgaaatactcagggcaagcctcgccttgccaagggaggttctttcaccctctgctggaacctatgatgtgaaacctaagactggaggtccattcggaaccatgaagcagtcagttgagcttgctcacggtgctaacaatggtcttgatattgctgtcaggctcttggagccaatcaaggagcaggaggttgcagggaggttgcagggagagacagcggtagcagctaggagaagatctgagactactcctgagctagacaagcacaataaccaggaaacacctgttatagtcaagtcctactatgacaatagaataattagatgccctggtgttgaaggaggtaaactcctccagctgcatctttgtcttccctactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00053 ko00480 map00053 map00480

Pfam Domains

Protein Families

peroxidase

Protein Analysis

156

Amino Acids

17.26

Weight (kDa)

5.4

Isoelectric Point (pI)

51.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002887)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890
fragaria_vesca	FvH4_3g33910
malus_domestica	MD03G1108200.v1.1 MD11G1121400.v1.1
prunus_persica	Prupe.6G091600_v2.0.a1 Prupe.6G091600_v2.0.a1 Prupe.6G091600_v2.0.a1
pyrus_communis	pycom03g08820 pycom11g10330
rosa_chinensis	RchiOBHm_Chr5g0061461
rosa_laevigata	RLG00000035480
rosa_multiflora	Rmu_sc0001527.1_g000034 Rmu_sc0003467.1_g000017 Rmu_sc0005050.1_g000006
rosa_roxburghii	Rroxscaffold_1G00009150 Rroxscaffold_1G00019220 Rroxscaffold_3G00255660 Rroxscaffold_5G00336730 Rroxscaffold_5G00368820
rosa_rugosa	Rorug05G0340500
rosa_samantha	Rh1AG201500 Rh1CG186400 Rh3CG141800 Rh4DG107700 Rh4DG192700 Rh5AG402900 Rh5BG415300 Rh5BG484500 Rh5CG440000 Rh5DG429900
rosa_wichuraiana	Rw5G037890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	308
AclWI	GGATC	1 cut(s)	33
AcsI	RAATTY	2 cut(s)	37, 50
AfiI	CCNNNNNNNGG	3 cut(s)	123, 146, 173
AgsI	TTSAA	1 cut(s)	428
AhdI	GACNNNNNGTC	1 cut(s)	177
AjnI	CCWGG	2 cut(s)	363, 418
AluBI	AGCT	4 cut(s)	211, 317, 346, 448
AluI	AGCT	4 cut(s)	211, 317, 346, 448
Alw26I	GTCTC	2 cut(s)	296, 326
AlwI	GGATC	1 cut(s)	33
ApeKI	GCWGC	2 cut(s)	314, 448
ApoI	RAATTY	2 cut(s)	37, 50
AspS9I	GGNCC	1 cut(s)	179
AsuHPI	GGTGA	3 cut(s)	95, 101, 129
AvaII	GGWCC	1 cut(s)	179
BbsI	GAAGAC	1 cut(s)	452
BbvI	GCAGC	2 cut(s)	326, 435
BccI	CCATC	1 cut(s)	80
BciT130I	CCWGG	2 cut(s)	365, 420
BcoDI	GTCTC	2 cut(s)	296, 326
BfaI	CTAG	2 cut(s)	318, 347
BglII	AGATCT	1 cut(s)	326
BisI	GCNGC	2 cut(s)	315, 449
BlsI	GCNGC	2 cut(s)	316, 450
Bme1390I	CCNGG	2 cut(s)	365, 420
Bme18I	GGWCC	1 cut(s)	179
BmeRI	GACNNNNNGTC	1 cut(s)	177
BmgT120I	GGNCC	1 cut(s)	179
BmiI	GGNNCC	3 cut(s)	151, 190, 261
BmrFI	CCNGG	2 cut(s)	365, 420
BmsI	GCATC	2 cut(s)	404, 460
BpiI	GAAGAC	1 cut(s)	452
BplI	GAGNNNNNCTC	2 cut(s)	423, 455
BpmI	CTGGAG	2 cut(s)	195, 428
Bpu10I	CCTNAGC	1 cut(s)	342
BsaBI	GATNNNNATC	1 cut(s)	30
BsaJI	CCNNGG	2 cut(s)	122, 418
Bsc4I	CCNNNNNNNGG	3 cut(s)	123, 146, 173
Bse1I	ACTGG	1 cut(s)	178
Bse8I	GATNNNNATC	1 cut(s)	30
BseBI	CCWGG	2 cut(s)	365, 420
BseDI	CCNNGG	2 cut(s)	122, 418
BseJI	GATNNNNATC	1 cut(s)	30
BseLI	CCNNNNNNNGG	3 cut(s)	123, 146, 173
BseMII	CTCAG	3 cut(s)	115, 321, 333
BseNI	ACTGG	1 cut(s)	178
BseRI	GAGGAG	1 cut(s)	431
BseXI	GCAGC	2 cut(s)	326, 435
BslI	CCNNNNNNNGG	3 cut(s)	123, 146, 173
BsmAI	GTCTC	2 cut(s)	296, 326
Bsp143I	GATC	2 cut(s)	25, 326
BspACI	CCGC	1 cut(s)	308
BspCNI	CTCAG	3 cut(s)	114, 322, 334
BspLI	GGNNCC	3 cut(s)	151, 190, 261
BspPI	GGATC	1 cut(s)	33
BsrI	ACTGG	1 cut(s)	178
BssECI	CCNNGG	2 cut(s)	122, 418
BssMI	GATC	2 cut(s)	25, 326
BssT1I	CCWWGG	1 cut(s)	122
Bst2UI	CCWGG	2 cut(s)	365, 420
Bst4CI	ACNGT	1 cut(s)	221
BstC8I	GCNNGC	2 cut(s)	109, 213
BstDEI	CTNAG	4 cut(s)	101, 168, 330, 342
BstENI	CCTNNNNNAGG	1 cut(s)	121
BstKTI	GATC	2 cut(s)	28, 329
BstMAI	GTCTC	2 cut(s)	296, 326
BstMBI	GATC	2 cut(s)	25, 326
BstMWI	GCNNNNNNNGC	5 cut(s)	113, 221, 259, 314, 352
BstNI	CCWGG	2 cut(s)	365, 420
BstSCI	CCNGG	2 cut(s)	363, 418
BstV1I	GCAGC	2 cut(s)	326, 435
BstV2I	GAAGAC	1 cut(s)	452
BstX2I	RGATCY	2 cut(s)	25, 326
BstYI	RGATCY	2 cut(s)	25, 326
BtsIMutI	CAGTG	1 cut(s)	67
Cac8I	GCNNGC	2 cut(s)	109, 213
Cfr13I	GGNCC	1 cut(s)	179
CviAII	CATG	1 cut(s)	193
CviJI	RGCY	7 cut(s)	111, 211, 253, 262, 317, 346, 448
CviKI_1	RGCY	7 cut(s)	111, 211, 253, 262, 317, 346, 448
DdeI	CTNAG	4 cut(s)	101, 168, 330, 342
DpnI	GATC	2 cut(s)	27, 328
DpnII	GATC	2 cut(s)	25, 326
DriI	GACNNNNNGTC	1 cut(s)	177
Eam1105I	GACNNNNNGTC	1 cut(s)	177
Eco130I	CCWWGG	1 cut(s)	122
Eco47I	GGWCC	1 cut(s)	179
EcoNI	CCTNNNNNAGG	1 cut(s)	121
EcoRII	CCWGG	2 cut(s)	363, 418
EcoT14I	CCWWGG	1 cut(s)	122
ErhI	CCWWGG	1 cut(s)	122
FaeI	CATG	1 cut(s)	196
FaiI	YATR	6 cut(s)	19, 23, 156, 194, 380, 396
FatI	CATG	1 cut(s)	192
Fnu4HI	GCNGC	2 cut(s)	315, 449
Fsp4HI	GCNGC	2 cut(s)	315, 449
FspBI	CTAG	2 cut(s)	318, 347
GluI	GCNGC	2 cut(s)	315, 449
GsuI	CTGGAG	2 cut(s)	195, 428
Hin1II	CATG	1 cut(s)	196
HinfI	GANTC	1 cut(s)	57
HphI	GGTGA	3 cut(s)	95, 101, 129
Hpy166II	GTNNAC	1 cut(s)	437
Hpy188I	TCNGA	4 cut(s)	36, 56, 188, 331
Hpy188III	TCNNGA	2 cut(s)	236, 341
Hpy8I	GTNNAC	1 cut(s)	437
HpyAV	CCTTC	1 cut(s)	422
HpyCH4III	ACNGT	1 cut(s)	221
HpyCH4V	TGCA	3 cut(s)	284, 295, 451
HpyF10VI	GCNNNNNNNGC	5 cut(s)	113, 221, 259, 314, 352
HpyF3I	CTNAG	4 cut(s)	101, 168, 330, 342
Hsp92II	CATG	1 cut(s)	196
Kzo9I	GATC	2 cut(s)	25, 326
LmnI	GCTCC	2 cut(s)	259, 271
Lsp1109I	GCAGC	2 cut(s)	326, 435
LweI	GCATC	2 cut(s)	404, 460
MaeI	CTAG	2 cut(s)	318, 347
MalI	GATC	2 cut(s)	27, 328
MboI	GATC	2 cut(s)	25, 326
MboII	GAAGA	4 cut(s)	20, 80, 336, 452
MflI	RGATCY	2 cut(s)	25, 326
MluCI	AATT	3 cut(s)	37, 50, 408
MnlI	CCTC	8 cut(s)	121, 122, 151, 170, 271, 282, 425, 452
MspA1I	CMGCKG	2 cut(s)	308, 448
MspR9I	CCNGG	2 cut(s)	365, 420
MvaI	CCWGG	2 cut(s)	365, 420
MwoI	GCNNNNNNNGC	5 cut(s)	113, 221, 259, 314, 352
NdeII	GATC	2 cut(s)	25, 326
NlaIII	CATG	1 cut(s)	196
NlaIV	GGNNCC	3 cut(s)	151, 190, 261
PfeI	GAWTC	1 cut(s)	57
PkrI	GCNGC	2 cut(s)	316, 450
Psp6I	CCWGG	2 cut(s)	363, 418
PspGI	CCWGG	2 cut(s)	363, 418
PspN4I	GGNNCC	3 cut(s)	151, 190, 261
PspPI	GGNCC	1 cut(s)	179
PsuI	RGATCY	2 cut(s)	25, 326
PvuII	CAGCTG	1 cut(s)	448
SatI	GCNGC	2 cut(s)	315, 449
Sau3AI	GATC	2 cut(s)	25, 326
Sau96I	GGNCC	1 cut(s)	179
ScrFI	CCNGG	2 cut(s)	365, 420
SfaNI	GCATC	2 cut(s)	404, 460
SinI	GGWCC	1 cut(s)	179
Sse9I	AATT	3 cut(s)	37, 50, 408
SsiI	CCGC	1 cut(s)	308
SspMI	CTAG	2 cut(s)	318, 347
StyD4I	CCNGG	2 cut(s)	363, 418
StyI	CCWWGG	1 cut(s)	122
TaaI	ACNGT	1 cut(s)	221
TasI	AATT	3 cut(s)	37, 50, 408
TfiI	GAWTC	1 cut(s)	57
TscAI	CASTG	1 cut(s)	67
TseI	GCWGC	2 cut(s)	314, 448
TspDTI	ATGAA	3 cut(s)	20, 108, 209
TspRI	CASTG	1 cut(s)	67
VpaK11BI	GGWCC	1 cut(s)	179
XagI	CCTNNNNNAGG	1 cut(s)	121
XapI	RAATTY	2 cut(s)	37, 50
XcmI	CCANNNNNNNNNTGG	1 cut(s)	19
XspI	CTAG	2 cut(s)	318, 347

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.