Rh1AG201500

Belongs to the peroxidase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
38179834 .. 38180896
1063 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG201500.1

Sequence Viewer

Length: 318 bp
ATGGTGATGAAATACTCAGGGCAAGCCTCGCCTTGCCAAGTTTTACGAATTTCAGGGGAGGTTCTTTCACTCTCTGCTGGAACCTATGATGTGAAACCTAAGACTAGAGGTCCATTCGGAACCATGAAGCAGTCAGCTGAGCTTGCTCACGGTGCTAACAATGGTCCTGATATTGCTGTCAGGCTCTTGGAGCCAATCAAGGAGCAGTTCCCTATTCTCTCTTACGCTGACTTCTACCAGTTGGCTGGAGTTGTTGCTGTCGATGTCACTGGGTACTTAATGTTCCATTCCATCCAGGAAGAGAGTTTTGAGCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.47

Weight (kDa)

5.21

Isoelectric Point (pI)

29.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 44 - 92 1e-05 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 48
AfaI GTAC 1 cut(s) 275
AhdI GACNNNNNGTC 1 cut(s) 108
AjnI CCWGG 1 cut(s) 294
AluBI AGCT 2 cut(s) 137, 142
AluI AGCT 2 cut(s) 137, 142
ApoI RAATTY 1 cut(s) 48
AspS9I GGNCC 2 cut(s) 110, 164
AsuHPI GGTGA 1 cut(s) 16
AvaII GGWCC 2 cut(s) 110, 164
BccI CCATC 1 cut(s) 299
BciT130I CCWGG 1 cut(s) 296
BfaI CTAG 1 cut(s) 105
BlpI GCTNAGC 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 296
Bme18I GGWCC 2 cut(s) 110, 164
BmeRI GACNNNNNGTC 1 cut(s) 108
BmgT120I GGNCC 2 cut(s) 110, 164
BmiI GGNNCC 3 cut(s) 82, 121, 192
BmrFI CCNGG 1 cut(s) 296
BmrI ACTGGG 1 cut(s) 279
BmuI ACTGGG 1 cut(s) 279
BpmI CTGGAG 1 cut(s) 267
Bpu1102I GCTNAGC 1 cut(s) 138
Bse1I ACTGG 2 cut(s) 238, 274
BseBI CCWGG 1 cut(s) 296
BseGI GGATG 1 cut(s) 291
BseMII CTCAG 2 cut(s) 30, 129
BseNI ACTGG 2 cut(s) 238, 274
Bsp1720I GCTNAGC 1 cut(s) 138
BspCNI CTCAG 2 cut(s) 29, 130
BspLI GGNNCC 3 cut(s) 82, 121, 192
BsrI ACTGG 2 cut(s) 238, 274
Bst2UI CCWGG 1 cut(s) 296
Bst4CI ACNGT 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 294
BstC8I GCNNGC 2 cut(s) 24, 144
BstDEI CTNAG 3 cut(s) 16, 99, 138
BstF5I GGATG 1 cut(s) 291
BstMWI GCNNNNNNNGC 4 cut(s) 28, 143, 152, 190
BstNI CCWGG 1 cut(s) 296
BstSCI CCNGG 1 cut(s) 294
BstXI CCANNNNNNTGG 1 cut(s) 245
BtsCI GGATG 1 cut(s) 291
BtsIMutI CAGTG 1 cut(s) 267
Cac8I GCNNGC 2 cut(s) 24, 144
Cfr13I GGNCC 2 cut(s) 110, 164
Csp6I GTAC 1 cut(s) 274
CviAII CATG 1 cut(s) 124
CviJI RGCY 6 cut(s) 26, 137, 142, 184, 193, 245
CviKI_1 RGCY 6 cut(s) 26, 137, 142, 184, 193, 245
CviQI GTAC 1 cut(s) 274
DdeI CTNAG 3 cut(s) 16, 99, 138
DriI GACNNNNNGTC 1 cut(s) 108
Eam1104I CTCTTC 1 cut(s) 294
Eam1105I GACNNNNNGTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 294
Eco47I GGWCC 2 cut(s) 110, 164
EcoRII CCWGG 1 cut(s) 294
FaeI CATG 1 cut(s) 127
FaiI YATR 2 cut(s) 87, 125
FatI CATG 1 cut(s) 123
FokI GGATG 1 cut(s) 278
FspBI CTAG 1 cut(s) 105
GsuI CTGGAG 1 cut(s) 267
Hin1II CATG 1 cut(s) 127
HphI GGTGA 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 119
Hpy188III TCNNGA 1 cut(s) 167
HpyCH4III ACNGT 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 4 cut(s) 28, 143, 152, 190
HpyF3I CTNAG 3 cut(s) 16, 99, 138
Hsp92II CATG 1 cut(s) 127
LmnI GCTCC 2 cut(s) 190, 202
MaeI CTAG 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 265
MboII GAAGA 1 cut(s) 311
MluCI AATT 1 cut(s) 48
MnlI CCTC 3 cut(s) 37, 52, 101
MseI TTAA 1 cut(s) 278
MspA1I CMGCKG 1 cut(s) 137
MspR9I CCNGG 1 cut(s) 296
MvaI CCWGG 1 cut(s) 296
MwoI GCNNNNNNNGC 4 cut(s) 28, 143, 152, 190
NlaIII CATG 1 cut(s) 127
NlaIV GGNNCC 3 cut(s) 82, 121, 192
NmuCI GTSAC 1 cut(s) 265
PfoI TCCNGGA 1 cut(s) 294
Psp6I CCWGG 1 cut(s) 294
PspGI CCWGG 1 cut(s) 294
PspN4I GGNNCC 3 cut(s) 82, 121, 192
PspPI GGNCC 2 cut(s) 110, 164
PsrI GAACNNNNNNTAC 2 cut(s) 266, 298
PvuII CAGCTG 1 cut(s) 137
RsaI GTAC 1 cut(s) 275
RsaNI GTAC 1 cut(s) 274
SaqAI TTAA 1 cut(s) 278
Sau96I GGNCC 2 cut(s) 110, 164
ScrFI CCNGG 1 cut(s) 296
SetI ASST 6 cut(s) 63, 86, 100, 112, 139, 144
SinI GGWCC 2 cut(s) 110, 164
Sse9I AATT 1 cut(s) 48
SspMI CTAG 1 cut(s) 105
StyD4I CCNGG 1 cut(s) 294
TaaI ACNGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 261
TasI AATT 1 cut(s) 48
Tru1I TTAA 1 cut(s) 278
Tru9I TTAA 1 cut(s) 278
TscAI CASTG 1 cut(s) 274
TseFI GTSAC 1 cut(s) 265
Tsp45I GTSAC 1 cut(s) 265
TspDTI ATGAA 2 cut(s) 23, 140
TspRI CASTG 1 cut(s) 274
VpaK11BI GGWCC 2 cut(s) 110, 164
XapI RAATTY 1 cut(s) 48
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.