Rmu_sc0005050.1_g000006

Belongs to the peroxidase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005050.1
OG0002887
Physical Location & Seq
Forward (+)
18675 .. 19127
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005050.1_g000006.1.cds

Sequence Viewer

Length: 330 bp
atggaggagaaaatggaggaaaccaaaatatgtatgtatcttcatctgaattttgatcagaaattcagaatcagtggagaagatgatacgagcggtgatggtgatgaaatactcagggcaagcctcgccttgccaagggaggttctttcaccctctgctggaacctatgatgtgaaacctaagactggaggtccattcggaaccatgaagcagtcagctgagcttgctcacggtgctaacaatggtcttgatattgctgtcaggctcttggagccaatcaaggagcagttccctattctctcttacgctgacttctaccaggtaaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00053 ko00480 map00053 map00480
Pfam Domains
Protein Families
peroxidase

Protein Analysis

109

Amino Acids

12.13

Weight (kDa)

4.83

Isoelectric Point (pI)

47.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 93
AciI CCGC 1 cut(s) 93
AcsI RAATTY 2 cut(s) 49, 62
AfiI CCNNNNNNNGG 3 cut(s) 135, 158, 185
AhdI GACNNNNNGTC 1 cut(s) 189
AjnI CCWGG 1 cut(s) 318
AluBI AGCT 2 cut(s) 218, 223
AluI AGCT 2 cut(s) 218, 223
ApoI RAATTY 2 cut(s) 49, 62
AspS9I GGNCC 1 cut(s) 191
AsuHPI GGTGA 3 cut(s) 107, 113, 141
AvaII GGWCC 1 cut(s) 191
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 320
BclI TGATCA 1 cut(s) 55
BlpI GCTNAGC 1 cut(s) 219
Bme1390I CCNGG 1 cut(s) 320
Bme18I GGWCC 1 cut(s) 191
BmeRI GACNNNNNGTC 1 cut(s) 189
BmgT120I GGNCC 1 cut(s) 191
BmiI GGNNCC 3 cut(s) 163, 202, 273
BmrFI CCNGG 1 cut(s) 320
BpmI CTGGAG 1 cut(s) 207
Bpu1102I GCTNAGC 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 134
Bsc4I CCNNNNNNNGG 3 cut(s) 135, 158, 185
Bse1I ACTGG 1 cut(s) 190
BseBI CCWGG 1 cut(s) 320
BseDI CCNNGG 1 cut(s) 134
BseLI CCNNNNNNNGG 3 cut(s) 135, 158, 185
BseMII CTCAG 2 cut(s) 127, 210
BseNI ACTGG 1 cut(s) 190
BseRI GAGGAG 1 cut(s) 20
BslI CCNNNNNNNGG 3 cut(s) 135, 158, 185
Bsp143I GATC 1 cut(s) 55
Bsp1720I GCTNAGC 1 cut(s) 219
BspACI CCGC 1 cut(s) 93
BspCNI CTCAG 2 cut(s) 126, 211
BspLI GGNNCC 3 cut(s) 163, 202, 273
BsrBI CCGCTC 1 cut(s) 93
BsrI ACTGG 1 cut(s) 190
BssECI CCNNGG 1 cut(s) 134
BssMI GATC 1 cut(s) 55
BssT1I CCWWGG 1 cut(s) 134
Bst2UI CCWGG 1 cut(s) 320
Bst4CI ACNGT 1 cut(s) 233
BstC8I GCNNGC 2 cut(s) 121, 225
BstDEI CTNAG 3 cut(s) 113, 180, 219
BstENI CCTNNNNNAGG 1 cut(s) 133
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstMWI GCNNNNNNNGC 4 cut(s) 125, 224, 233, 271
BstNI CCWGG 1 cut(s) 320
BstSCI CCNGG 1 cut(s) 318
BtsIMutI CAGTG 1 cut(s) 79
Cac8I GCNNGC 2 cut(s) 121, 225
Cfr13I GGNCC 1 cut(s) 191
CsiI ACCWGGT 1 cut(s) 318
CviAII CATG 1 cut(s) 205
CviJI RGCY 5 cut(s) 123, 218, 223, 265, 274
CviKI_1 RGCY 5 cut(s) 123, 218, 223, 265, 274
DdeI CTNAG 3 cut(s) 113, 180, 219
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
DriI GACNNNNNGTC 1 cut(s) 189
Eam1105I GACNNNNNGTC 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 134
Eco47I GGWCC 1 cut(s) 191
EcoNI CCTNNNNNAGG 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 318
EcoT14I CCWWGG 1 cut(s) 134
ErhI CCWWGG 1 cut(s) 134
FaeI CATG 1 cut(s) 208
FaiI YATR 4 cut(s) 31, 35, 168, 206
FatI CATG 1 cut(s) 204
FbaI TGATCA 1 cut(s) 55
GsuI CTGGAG 1 cut(s) 207
Hin1II CATG 1 cut(s) 208
HinfI GANTC 1 cut(s) 69
HphI GGTGA 3 cut(s) 107, 113, 141
Hpy188I TCNGA 4 cut(s) 48, 60, 68, 200
Hpy188III TCNNGA 1 cut(s) 248
HpyCH4III ACNGT 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 4 cut(s) 125, 224, 233, 271
HpyF3I CTNAG 3 cut(s) 113, 180, 219
Hsp92II CATG 1 cut(s) 208
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 1 cut(s) 55
LmnI GCTCC 2 cut(s) 271, 283
LpnPI CCDG 5 cut(s) 100, 144, 171, 247, 305
MabI ACCWGGT 1 cut(s) 318
MalI GATC 1 cut(s) 57
MbiI CCGCTC 1 cut(s) 93
MboI GATC 1 cut(s) 55
MboII GAAGA 2 cut(s) 32, 92
MluCI AATT 2 cut(s) 49, 62
MnlI CCTC 5 cut(s) 10, 133, 134, 163, 182
MspA1I CMGCKG 1 cut(s) 218
MspR9I CCNGG 1 cut(s) 320
MvaI CCWGG 1 cut(s) 320
MwoI GCNNNNNNNGC 4 cut(s) 125, 224, 233, 271
NdeII GATC 1 cut(s) 55
NlaIII CATG 1 cut(s) 208
NlaIV GGNNCC 3 cut(s) 163, 202, 273
PfeI GAWTC 1 cut(s) 69
Psp6I CCWGG 1 cut(s) 318
PspGI CCWGG 1 cut(s) 318
PspN4I GGNNCC 3 cut(s) 163, 202, 273
PspPI GGNCC 1 cut(s) 191
PvuII CAGCTG 1 cut(s) 218
Sau3AI GATC 1 cut(s) 55
Sau96I GGNCC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 320
SetI ASST 7 cut(s) 144, 167, 181, 193, 220, 225, 324
SexAI ACCWGGT 1 cut(s) 318
SinI GGWCC 1 cut(s) 191
Sse9I AATT 2 cut(s) 49, 62
SsiI CCGC 1 cut(s) 93
StyD4I CCNGG 1 cut(s) 318
StyI CCWWGG 1 cut(s) 134
TaaI ACNGT 1 cut(s) 233
TasI AATT 2 cut(s) 49, 62
TfiI GAWTC 1 cut(s) 69
TscAI CASTG 1 cut(s) 79
TspDTI ATGAA 3 cut(s) 32, 120, 221
TspRI CASTG 1 cut(s) 79
VpaK11BI GGWCC 1 cut(s) 191
XagI CCTNNNNNAGG 1 cut(s) 133
XapI RAATTY 2 cut(s) 49, 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.