Rh4DG107700

Belongs to the peroxidase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0002887
Physical Location & Seq
Reverse (-)
16521671 .. 16526448
4778 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG107700.1

Sequence Viewer

Length: 327 bp
ATGATACGAGCGGTGATGGTGATGAAATACTCAGGGCAAGCCTCGCCTTGCCAAGTTTTAAGAATTTCAGGGGAGGTTCTTTCACTCTCTGCTGGAACCTATGATGTGAAACCTAAGACTGGAGGTCCATTCGGAACCATGAAGCAGTCAGCTGAGCTTGCTCACGGTGCTAACAATGGTCTTGATATTGCTGTCAGGCTCTTGGAGCCAATCAAGGAGCAGTTCCCTATTCTCTCTTACGCTGACTTCTACCAGTTGGCTGGAGTTGTTGCTGTCGATGTCACTGGTGGACCTAATGTTCCATTCCATCCAGGAAGAGAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00053 ko00480 map00053 map00480
Pfam Domains
Protein Families
peroxidase

Protein Analysis

108

Amino Acids

11.52

Weight (kDa)

6.71

Isoelectric Point (pI)

27.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 48 - 107 8.6e-12 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 11
AciI CCGC 1 cut(s) 11
AcsI RAATTY 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 119
AhdI GACNNNNNGTC 1 cut(s) 123
AjnI CCWGG 1 cut(s) 310
AloI GAACNNNNNNTCC 2 cut(s) 282, 314
AluBI AGCT 2 cut(s) 152, 157
AluI AGCT 2 cut(s) 152, 157
ApoI RAATTY 1 cut(s) 63
AspS9I GGNCC 2 cut(s) 125, 290
AsuHPI GGTGA 2 cut(s) 25, 31
AvaII GGWCC 2 cut(s) 125, 290
BccI CCATC 2 cut(s) 10, 315
BciT130I CCWGG 1 cut(s) 312
BlpI GCTNAGC 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 312
Bme18I GGWCC 2 cut(s) 125, 290
BmeRI GACNNNNNGTC 1 cut(s) 123
BmgT120I GGNCC 2 cut(s) 125, 290
BmiI GGNNCC 3 cut(s) 97, 136, 207
BmrFI CCNGG 1 cut(s) 312
BpmI CTGGAG 2 cut(s) 141, 282
Bpu1102I GCTNAGC 1 cut(s) 153
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse1I ACTGG 3 cut(s) 124, 253, 289
BseBI CCWGG 1 cut(s) 312
BseGI GGATG 1 cut(s) 307
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMII CTCAG 2 cut(s) 45, 144
BseNI ACTGG 3 cut(s) 124, 253, 289
BslI CCNNNNNNNGG 1 cut(s) 119
Bsp1720I GCTNAGC 1 cut(s) 153
BspACI CCGC 1 cut(s) 11
BspCNI CTCAG 2 cut(s) 44, 145
BspLI GGNNCC 3 cut(s) 97, 136, 207
BsrBI CCGCTC 1 cut(s) 11
BsrI ACTGG 3 cut(s) 124, 253, 289
Bst2UI CCWGG 1 cut(s) 312
Bst4CI ACNGT 1 cut(s) 167
Bst6I CTCTTC 1 cut(s) 310
BstC8I GCNNGC 2 cut(s) 39, 159
BstDEI CTNAG 3 cut(s) 31, 114, 153
BstF5I GGATG 1 cut(s) 307
BstMWI GCNNNNNNNGC 4 cut(s) 43, 158, 167, 205
BstNI CCWGG 1 cut(s) 312
BstSCI CCNGG 1 cut(s) 310
BstXI CCANNNNNNTGG 1 cut(s) 260
BtsCI GGATG 1 cut(s) 307
BtsIMutI CAGTG 1 cut(s) 282
Cac8I GCNNGC 2 cut(s) 39, 159
Cfr13I GGNCC 2 cut(s) 125, 290
CviAII CATG 1 cut(s) 139
CviJI RGCY 6 cut(s) 41, 152, 157, 199, 208, 260
CviKI_1 RGCY 6 cut(s) 41, 152, 157, 199, 208, 260
DdeI CTNAG 3 cut(s) 31, 114, 153
DriI GACNNNNNGTC 1 cut(s) 123
Eam1104I CTCTTC 1 cut(s) 310
Eam1105I GACNNNNNGTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 310
Eco47I GGWCC 2 cut(s) 125, 290
EcoRII CCWGG 1 cut(s) 310
FaeI CATG 1 cut(s) 142
FaiI YATR 2 cut(s) 102, 140
FatI CATG 1 cut(s) 138
FokI GGATG 1 cut(s) 294
GsuI CTGGAG 2 cut(s) 141, 282
Hin1II CATG 1 cut(s) 142
HphI GGTGA 2 cut(s) 25, 31
Hpy166II GTNNAC 1 cut(s) 290
Hpy188I TCNGA 1 cut(s) 134
Hpy188III TCNNGA 1 cut(s) 182
Hpy8I GTNNAC 1 cut(s) 290
HpyCH4III ACNGT 1 cut(s) 167
HpyF10VI GCNNNNNNNGC 4 cut(s) 43, 158, 167, 205
HpyF3I CTNAG 3 cut(s) 31, 114, 153
Hsp92II CATG 1 cut(s) 142
LmnI GCTCC 2 cut(s) 205, 217
LpnPI CCDG 9 cut(s) 18, 54, 78, 105, 181, 246, 266, 270, 297
MaeIII GTNAC 1 cut(s) 280
MbiI CCGCTC 1 cut(s) 11
MboII GAAGA 1 cut(s) 327
MluCI AATT 1 cut(s) 63
MnlI CCTC 3 cut(s) 52, 67, 116
MseI TTAA 1 cut(s) 59
MspA1I CMGCKG 1 cut(s) 152
MspR9I CCNGG 1 cut(s) 312
MvaI CCWGG 1 cut(s) 312
MwoI GCNNNNNNNGC 4 cut(s) 43, 158, 167, 205
NlaIII CATG 1 cut(s) 142
NlaIV GGNNCC 3 cut(s) 97, 136, 207
NmuCI GTSAC 1 cut(s) 280
PfoI TCCNGGA 1 cut(s) 310
Psp6I CCWGG 1 cut(s) 310
PspGI CCWGG 1 cut(s) 310
PspN4I GGNNCC 3 cut(s) 97, 136, 207
PspPI GGNCC 2 cut(s) 125, 290
PvuII CAGCTG 1 cut(s) 152
SaqAI TTAA 1 cut(s) 59
Sau96I GGNCC 2 cut(s) 125, 290
ScrFI CCNGG 1 cut(s) 312
SetI ASST 7 cut(s) 78, 101, 115, 127, 154, 159, 295
SinI GGWCC 2 cut(s) 125, 290
Sse9I AATT 1 cut(s) 63
SsiI CCGC 1 cut(s) 11
StyD4I CCNGG 1 cut(s) 310
TaaI ACNGT 1 cut(s) 167
TaqI TCGA 1 cut(s) 276
TasI AATT 1 cut(s) 63
Tru1I TTAA 1 cut(s) 59
Tru9I TTAA 1 cut(s) 59
TscAI CASTG 1 cut(s) 289
TseFI GTSAC 1 cut(s) 280
Tsp45I GTSAC 1 cut(s) 280
TspDTI ATGAA 2 cut(s) 38, 155
TspRI CASTG 1 cut(s) 289
VpaK11BI GGWCC 2 cut(s) 125, 290
XapI RAATTY 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.