Rh3CG141800

Belongs to the peroxidase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
11695248 .. 11695683
436 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG141800.1

Sequence Viewer

Length: 198 bp
ATGGAGGAAACCAAAATATGTATGGATCTTCATCTGAATTTTGATCGGAAATTCAGAATCAGTGGAGAAGATGATACAAGCGGTGATGGTGATAAAATACTCAGGGCAAGCCTCGCCTTGCCAAGTTTTACGAATTTCAGGCTCTTGGAGCCAATCAAGGAGCAGTTCCCTATTCTCTCTTATGCTGACTTCTACCAG

Protein Analysis

66

Amino Acids

7.69

Weight (kDa)

4.72

Isoelectric Point (pI)

36.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 81
AclWI GGATC 1 cut(s) 33
AcsI RAATTY 3 cut(s) 37, 50, 133
AlwI GGATC 1 cut(s) 33
ApoI RAATTY 3 cut(s) 37, 50, 133
AsuHPI GGTGA 2 cut(s) 95, 101
BccI CCATC 1 cut(s) 80
BmiI GGNNCC 1 cut(s) 150
BsaBI GATNNNNATC 1 cut(s) 30
Bse8I GATNNNNATC 1 cut(s) 30
BseJI GATNNNNATC 1 cut(s) 30
BseMII CTCAG 1 cut(s) 115
Bsp143I GATC 2 cut(s) 25, 43
BspACI CCGC 1 cut(s) 81
BspCNI CTCAG 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 150
BspPI GGATC 1 cut(s) 33
BssMI GATC 2 cut(s) 25, 43
BstC8I GCNNGC 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 101
BstKTI GATC 2 cut(s) 28, 46
BstMBI GATC 2 cut(s) 25, 43
BstMWI GCNNNNNNNGC 2 cut(s) 113, 148
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 109
CviJI RGCY 3 cut(s) 111, 142, 151
CviKI_1 RGCY 3 cut(s) 111, 142, 151
DdeI CTNAG 1 cut(s) 101
DpnI GATC 2 cut(s) 27, 45
DpnII GATC 2 cut(s) 25, 43
FaiI YATR 3 cut(s) 19, 23, 183
HinfI GANTC 1 cut(s) 57
HphI GGTGA 2 cut(s) 95, 101
Hpy188I TCNGA 3 cut(s) 36, 48, 56
HpyF10VI GCNNNNNNNGC 2 cut(s) 113, 148
HpyF3I CTNAG 1 cut(s) 101
Kzo9I GATC 2 cut(s) 25, 43
LmnI GCTCC 2 cut(s) 148, 160
LpnPI CCDG 2 cut(s) 88, 124
MalI GATC 2 cut(s) 27, 45
MboI GATC 2 cut(s) 25, 43
MboII GAAGA 2 cut(s) 20, 80
MflI RGATCY 1 cut(s) 25
MluCI AATT 3 cut(s) 37, 50, 133
MnlI CCTC 1 cut(s) 122
MwoI GCNNNNNNNGC 2 cut(s) 113, 148
NdeII GATC 2 cut(s) 25, 43
NlaIV GGNNCC 1 cut(s) 150
PfeI GAWTC 1 cut(s) 57
PspN4I GGNNCC 1 cut(s) 150
PsuI RGATCY 1 cut(s) 25
Sau3AI GATC 2 cut(s) 25, 43
SgeI CNNG 9 cut(s) 90, 115, 120, 125, 130, 135, 151, 157, 169
Sse9I AATT 3 cut(s) 37, 50, 133
SsiI CCGC 1 cut(s) 81
TasI AATT 3 cut(s) 37, 50, 133
TfiI GAWTC 1 cut(s) 57
TscAI CASTG 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 20
TspRI CASTG 1 cut(s) 67
XapI RAATTY 3 cut(s) 37, 50, 133
XcmI CCANNNNNNNNNTGG 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.