Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003467.1

Orthogroup ID

OG0002887

Physical Location & Seq

Genomic Coordinates Forward (+)

58593 .. 59047

Gene Structure 455 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003467.1_g000017.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 330 bp

atggaggagaaaatggaggaaaccaaaatatgtatggatcttcatctgaattttgatcggaaattcagaatcagtggagcagatgatacgagcggtgatggtgatgaaatactcagggcaagcctcgccttgccaagggaggttctttcactctctgctggaacctatgatgtgaaacctaagactggaggtccattcggaaccatgaagcagtcagctgagcttgctcacggtgctaacaatggtcttgatattgctgtcaggctcttggagccaatcaaggagcagttccctattctctcttacgctgacttctaccaggtaaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00053 ko00480 map00053 map00480

Pfam Domains

Protein Families

peroxidase

Protein Analysis

109

Amino Acids

12.06

Weight (kDa)

4.95

Isoelectric Point (pI)

36.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002887)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890 AT1G07890
fragaria_vesca	FvH4_3g33910
malus_domestica	MD03G1108200.v1.1 MD11G1121400.v1.1
prunus_persica	Prupe.6G091600_v2.0.a1 Prupe.6G091600_v2.0.a1 Prupe.6G091600_v2.0.a1
pyrus_communis	pycom03g08820 pycom11g10330
rosa_chinensis	RchiOBHm_Chr5g0061461
rosa_laevigata	RLG00000035480
rosa_multiflora	Rmu_sc0001527.1_g000034 Rmu_sc0003467.1_g000017 Rmu_sc0005050.1_g000006
rosa_roxburghii	Rroxscaffold_1G00009150 Rroxscaffold_1G00019220 Rroxscaffold_3G00255660 Rroxscaffold_5G00336730 Rroxscaffold_5G00368820
rosa_rugosa	Rorug05G0340500
rosa_samantha	Rh1AG201500 Rh1CG186400 Rh3CG141800 Rh4DG107700 Rh4DG192700 Rh5AG402900 Rh5BG415300 Rh5BG484500 Rh5CG440000 Rh5DG429900
rosa_wichuraiana	Rw5G037890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	93
AciI	CCGC	1 cut(s)	93
AclWI	GGATC	1 cut(s)	45
AcsI	RAATTY	2 cut(s)	49, 62
AfiI	CCNNNNNNNGG	2 cut(s)	135, 185
AhdI	GACNNNNNGTC	1 cut(s)	189
AjnI	CCWGG	1 cut(s)	318
AluBI	AGCT	2 cut(s)	218, 223
AluI	AGCT	2 cut(s)	218, 223
AlwI	GGATC	1 cut(s)	45
ApoI	RAATTY	2 cut(s)	49, 62
AspS9I	GGNCC	1 cut(s)	191
AsuHPI	GGTGA	2 cut(s)	107, 113
AvaII	GGWCC	1 cut(s)	191
BccI	CCATC	1 cut(s)	92
BciT130I	CCWGG	1 cut(s)	320
BlpI	GCTNAGC	1 cut(s)	219
Bme1390I	CCNGG	1 cut(s)	320
Bme18I	GGWCC	1 cut(s)	191
BmeRI	GACNNNNNGTC	1 cut(s)	189
BmgT120I	GGNCC	1 cut(s)	191
BmiI	GGNNCC	3 cut(s)	163, 202, 273
BmrFI	CCNGG	1 cut(s)	320
BpmI	CTGGAG	1 cut(s)	207
Bpu1102I	GCTNAGC	1 cut(s)	219
BsaBI	GATNNNNATC	1 cut(s)	42
BsaJI	CCNNGG	1 cut(s)	134
Bsc4I	CCNNNNNNNGG	2 cut(s)	135, 185
Bse1I	ACTGG	1 cut(s)	190
Bse8I	GATNNNNATC	1 cut(s)	42
BseBI	CCWGG	1 cut(s)	320
BseDI	CCNNGG	1 cut(s)	134
BseJI	GATNNNNATC	1 cut(s)	42
BseLI	CCNNNNNNNGG	2 cut(s)	135, 185
BseMII	CTCAG	2 cut(s)	127, 210
BseNI	ACTGG	1 cut(s)	190
BseRI	GAGGAG	1 cut(s)	20
BslI	CCNNNNNNNGG	2 cut(s)	135, 185
Bsp143I	GATC	2 cut(s)	37, 55
Bsp1720I	GCTNAGC	1 cut(s)	219
BspACI	CCGC	1 cut(s)	93
BspCNI	CTCAG	2 cut(s)	126, 211
BspLI	GGNNCC	3 cut(s)	163, 202, 273
BspPI	GGATC	1 cut(s)	45
BsrBI	CCGCTC	1 cut(s)	93
BsrI	ACTGG	1 cut(s)	190
BssECI	CCNNGG	1 cut(s)	134
BssMI	GATC	2 cut(s)	37, 55
BssT1I	CCWWGG	1 cut(s)	134
Bst2UI	CCWGG	1 cut(s)	320
Bst4CI	ACNGT	1 cut(s)	233
BstC8I	GCNNGC	2 cut(s)	121, 225
BstDEI	CTNAG	3 cut(s)	113, 180, 219
BstENI	CCTNNNNNAGG	1 cut(s)	133
BstKTI	GATC	2 cut(s)	40, 58
BstMBI	GATC	2 cut(s)	37, 55
BstMWI	GCNNNNNNNGC	4 cut(s)	125, 224, 233, 271
BstNI	CCWGG	1 cut(s)	320
BstSCI	CCNGG	1 cut(s)	318
BstX2I	RGATCY	1 cut(s)	37
BstYI	RGATCY	1 cut(s)	37
BtsIMutI	CAGTG	1 cut(s)	79
Cac8I	GCNNGC	2 cut(s)	121, 225
Cfr13I	GGNCC	1 cut(s)	191
CsiI	ACCWGGT	1 cut(s)	318
CviAII	CATG	1 cut(s)	205
CviJI	RGCY	5 cut(s)	123, 218, 223, 265, 274
CviKI_1	RGCY	5 cut(s)	123, 218, 223, 265, 274
DdeI	CTNAG	3 cut(s)	113, 180, 219
DpnI	GATC	2 cut(s)	39, 57
DpnII	GATC	2 cut(s)	37, 55
DriI	GACNNNNNGTC	1 cut(s)	189
Eam1105I	GACNNNNNGTC	1 cut(s)	189
Eco130I	CCWWGG	1 cut(s)	134
Eco47I	GGWCC	1 cut(s)	191
EcoNI	CCTNNNNNAGG	1 cut(s)	133
EcoRII	CCWGG	1 cut(s)	318
EcoT14I	CCWWGG	1 cut(s)	134
ErhI	CCWWGG	1 cut(s)	134
FaeI	CATG	1 cut(s)	208
FaiI	YATR	4 cut(s)	31, 35, 168, 206
FatI	CATG	1 cut(s)	204
GsuI	CTGGAG	1 cut(s)	207
Hin1II	CATG	1 cut(s)	208
HinfI	GANTC	1 cut(s)	69
HphI	GGTGA	2 cut(s)	107, 113
Hpy188I	TCNGA	4 cut(s)	48, 60, 68, 200
Hpy188III	TCNNGA	1 cut(s)	248
HpyCH4III	ACNGT	1 cut(s)	233
HpyF10VI	GCNNNNNNNGC	4 cut(s)	125, 224, 233, 271
HpyF3I	CTNAG	3 cut(s)	113, 180, 219
Hsp92II	CATG	1 cut(s)	208
Kzo9I	GATC	2 cut(s)	37, 55
LmnI	GCTCC	3 cut(s)	77, 271, 283
LpnPI	CCDG	5 cut(s)	100, 144, 171, 247, 305
MabI	ACCWGGT	1 cut(s)	318
MalI	GATC	2 cut(s)	39, 57
MbiI	CCGCTC	1 cut(s)	93
MboI	GATC	2 cut(s)	37, 55
MboII	GAAGA	1 cut(s)	32
MflI	RGATCY	1 cut(s)	37
MluCI	AATT	2 cut(s)	49, 62
MnlI	CCTC	4 cut(s)	10, 133, 134, 182
MspA1I	CMGCKG	1 cut(s)	218
MspR9I	CCNGG	1 cut(s)	320
MvaI	CCWGG	1 cut(s)	320
MwoI	GCNNNNNNNGC	4 cut(s)	125, 224, 233, 271
NdeII	GATC	2 cut(s)	37, 55
NlaIII	CATG	1 cut(s)	208
NlaIV	GGNNCC	3 cut(s)	163, 202, 273
PfeI	GAWTC	1 cut(s)	69
Psp6I	CCWGG	1 cut(s)	318
PspGI	CCWGG	1 cut(s)	318
PspN4I	GGNNCC	3 cut(s)	163, 202, 273
PspPI	GGNCC	1 cut(s)	191
PsuI	RGATCY	1 cut(s)	37
PvuII	CAGCTG	1 cut(s)	218
Sau3AI	GATC	2 cut(s)	37, 55
Sau96I	GGNCC	1 cut(s)	191
ScrFI	CCNGG	1 cut(s)	320
SetI	ASST	7 cut(s)	144, 167, 181, 193, 220, 225, 324
SexAI	ACCWGGT	1 cut(s)	318
SinI	GGWCC	1 cut(s)	191
Sse9I	AATT	2 cut(s)	49, 62
SsiI	CCGC	1 cut(s)	93
StyD4I	CCNGG	1 cut(s)	318
StyI	CCWWGG	1 cut(s)	134
TaaI	ACNGT	1 cut(s)	233
TasI	AATT	2 cut(s)	49, 62
TfiI	GAWTC	1 cut(s)	69
TscAI	CASTG	1 cut(s)	79
TspDTI	ATGAA	3 cut(s)	32, 120, 221
TspRI	CASTG	1 cut(s)	79
VpaK11BI	GGWCC	1 cut(s)	191
XagI	CCTNNNNNAGG	1 cut(s)	133
XapI	RAATTY	2 cut(s)	49, 62
XcmI	CCANNNNNNNNNTGG	1 cut(s)	31

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.