Rh4DG192700

Belongs to the peroxidase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
37839052 .. 37842264
3213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG192700.1

Sequence Viewer

Length: 183 bp
ATGAAGCAGTCAGCTGAGCTTGCTTACGGTGCTAACAATGGTCTTGATATTGCTGTCAGGCTCTTGGAGCCAATCAAGGAGCAGTTCCCTATTCTCTCTTACACTGACTTCTACCAGCGTGGAATATTTGTTGCTGGCCTCAAAGAGAAAATTGTCAGTAAACGAGGCAGGTCATTTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.79

Weight (kDa)

9.52

Isoelectric Point (pI)

32.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 159
AluBI AGCT 2 cut(s) 14, 19
AluI AGCT 2 cut(s) 14, 19
AoxI GGCC 1 cut(s) 136
BfuAI ACCTGC 1 cut(s) 159
BlpI GCTNAGC 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 69
Bpu1102I GCTNAGC 1 cut(s) 15
BseMII CTCAG 1 cut(s) 6
BshFI GGCC 1 cut(s) 138
BsnI GGCC 1 cut(s) 138
Bsp1720I GCTNAGC 1 cut(s) 15
BspANI GGCC 1 cut(s) 138
BspCNI CTCAG 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 69
BspMI ACCTGC 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 29
BstC8I GCNNGC 2 cut(s) 21, 136
BstDEI CTNAG 1 cut(s) 15
BstMWI GCNNNNNNNGC 3 cut(s) 20, 29, 67
BsuRI GGCC 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 102
BveI ACCTGC 1 cut(s) 159
Cac8I GCNNGC 2 cut(s) 21, 136
CviJI RGCY 5 cut(s) 14, 19, 61, 70, 138
CviKI_1 RGCY 5 cut(s) 14, 19, 61, 70, 138
DdeI CTNAG 1 cut(s) 15
HaeIII GGCC 1 cut(s) 138
Hpy166II GTNNAC 1 cut(s) 161
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 1 cut(s) 161
HpyCH4III ACNGT 1 cut(s) 29
HpyF10VI GCNNNNNNNGC 3 cut(s) 20, 29, 67
HpyF3I CTNAG 1 cut(s) 15
LmnI GCTCC 2 cut(s) 67, 79
LpnPI CCDG 4 cut(s) 43, 120, 128, 154
MluCI AATT 2 cut(s) 150, 178
MnlI CCTC 2 cut(s) 149, 158
MseI TTAA 1 cut(s) 177
MspA1I CMGCKG 1 cut(s) 14
MwoI GCNNNNNNNGC 3 cut(s) 20, 29, 67
NlaIV GGNNCC 1 cut(s) 69
PspN4I GGNNCC 1 cut(s) 69
PvuII CAGCTG 1 cut(s) 14
SaqAI TTAA 1 cut(s) 177
SetI ASST 3 cut(s) 16, 21, 173
SgeI CNNG 9 cut(s) 32, 56, 70, 76, 88, 127, 131, 147, 176
Sse9I AATT 2 cut(s) 150, 178
SspI AATATT 1 cut(s) 126
TaaI ACNGT 1 cut(s) 29
TasI AATT 2 cut(s) 150, 178
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.